G204404


Basic Information

Item Value
gene id G204404
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000048
NCBI id null
chromosome length 1528931
location 273548 ~ 274177 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU232009
CTCAGAAAGATGGATTATTTTTCTTAAAATCTCTGTTTGTATTTCACTGAAAAAGAGGATGTCATAATCATCTGGAACAGAATAAGGGAGCAAAGAGCAAAACTGACAGTGGTGGAGAGAGAAGAAGTGCCCTTGAAGAGGAAACCATGGCAGCCATATAGTCAAGAAGAGATTTCCAAATGTGTCCAAAGAGGCTTTGAGGATTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU232009 True 207 lncRNA 0.39 3 273548 274177

Neighbor

gene id symbol gene type direction distance location
CI01000048_00261577_00264226 NA coding upstream 8006 261400 ~ 265542 (+)
CI01000048_00149401_00154452 NA coding upstream 119096 149401 ~ 154452 (+)
CI01000048_00036432_00113057 PSIP1 coding upstream 160491 36432 ~ 113057 (+)
CI01000048_00005001_00005627 NA coding upstream 267531 5001 ~ 6017 (+)
CI01000048_00403297_00404487 NA coding downstream 129055 403232 ~ 404614 (+)
CI01000048_00425103_00519682 NA coding downstream 150926 425103 ~ 519890 (+)
CI01000048_00567988_00568484 NA coding downstream 293811 567988 ~ 569052 (+)
CI01000048_00659494_00667971 NA coding downstream 384845 659022 ~ 670072 (+)
CI01000048_00693752_00694265 NA coding downstream 418895 693072 ~ 694474 (+)
G204403 NA non-coding upstream 1845 271489 ~ 271703 (+)
G204402 NA non-coding upstream 2353 270974 ~ 271195 (+)
G204401 NA non-coding upstream 4732 268556 ~ 268816 (+)
G204396 NA non-coding upstream 10072 263174 ~ 263476 (+)
G204392 NA non-coding downstream 2212 276389 ~ 277902 (+)
G204405 NA non-coding downstream 4127 278304 ~ 278519 (+)
G204406 NA non-coding downstream 4656 278833 ~ 279069 (+)
G204407 NA non-coding downstream 5170 279347 ~ 279743 (+)
G204408 NA non-coding downstream 5584 279761 ~ 280327 (+)
G204233 NA other upstream 209951 63188 ~ 63597 (+)
G204409 NA other downstream 11093 285270 ~ 285747 (+)
G204472 NA other downstream 86848 361025 ~ 361661 (+)
G204824 NA other downstream 719278 993455 ~ 993969 (+)
CI01000048_01214358_01215546 NA other downstream 940195 1214358 ~ 1215807 (+)

Expression


Co-expression Network