G454197


Basic Information

Item Value
gene id G454197
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 1111575 ~ 1111919 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU521474
AAATGGACTGTGGCAAAGTGGAAAACTGTTCTGTGGTCAGACGAATCAAAATTTGAAGTTCTTTTTGGAAAACTGGGACACCATGTCATCCGGACTAAAGAGGACAAGGACAACCCAAGTTGTTATCAGCGCTCAGTTCAGAAGCCTGCATCTCTGATGGTATGGGGTTGCATGAGTGCGTGTGGCATGGGCAGCTTACACATCTGGAAAGGCACCATCAATGCTGAAAGGTATATCCAAGTTCTAGAACAACATATGCTCCCCTTCCCTTTCAGGGAAGACCTTGCATTTTCCAACATGACAATGCCAGACCACATACTGAATCAATTACAACATCATGGCTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU521474 True 345 lncRNA 0.45 1 1111575 1111919

Neighbor

gene id symbol gene type direction distance location
CI01000320_01062113_01063824 NA coding upstream 47248 1061933 ~ 1064327 (+)
CI01000320_01050034_01055863 SRSF4 coding upstream 55468 1049755 ~ 1056107 (+)
CI01000320_01018345_01040605 ZFPM2B coding upstream 70361 1017163 ~ 1041214 (+)
CI01000320_00998626_01009523 NA coding upstream 100985 998626 ~ 1010590 (+)
CI01000320_00915850_00922116 NA coding upstream 189289 913093 ~ 922286 (+)
CI01000320_01366265_01378718 TMEM222 coding downstream 254346 1366265 ~ 1378933 (+)
CI01000320_01392029_01394001 TPBGL coding downstream 280054 1391973 ~ 1394253 (+)
CI01000320_01410702_01413113 NA coding downstream 298240 1410159 ~ 1414065 (+)
CI01000320_01415533_01416476 NA coding downstream 303614 1415533 ~ 1417101 (+)
CI01000320_01433381_01435726 NA coding downstream 321219 1433138 ~ 1435726 (+)
G454161 NA non-coding upstream 27513 1083638 ~ 1084062 (+)
G454188 NA non-coding upstream 110770 1000478 ~ 1000805 (+)
G454187 NA non-coding upstream 111549 999708 ~ 1000026 (+)
G454183 NA non-coding upstream 119780 991574 ~ 991795 (+)
G454179 NA non-coding upstream 123026 988292 ~ 988549 (+)
G454202 NA non-coding downstream 10269 1122188 ~ 1123504 (+)
G454213 NA non-coding downstream 20581 1132500 ~ 1132817 (+)
G454220 NA non-coding downstream 30246 1142165 ~ 1142491 (+)
G454223 NA non-coding downstream 33212 1145131 ~ 1145374 (+)
G454231 NA non-coding downstream 47670 1159589 ~ 1159839 (+)
G454251 NA other downstream 102659 1214578 ~ 1215032 (+)
G455129 NA other downstream 1078398 2190317 ~ 2197008 (+)
G455393 NA other downstream 1987905 3099824 ~ 3100289 (+)
CI01000320_03117532_03169741 NA other downstream 2005628 3115820 ~ 3169749 (+)
G455404 NA other downstream 2008897 3120816 ~ 3121105 (+)

Expression


Co-expression Network