G43030



Basic Information


Item Value
gene id G43030
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 32117889 ~ 32138685 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU57811
aggatactatgcatcctgataaagttcccttggcctttggaattaaaatagccccacatcatcacatacctttcaccatacctacagattggcatggttttatgtcggttagcctaatagctggtttgatttgcattgagagatgattttatggaaagtaccccatgccaatctctgggtatggtgaagggtatgtgatgatgtgggg

Function


GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA


RNA id representative length rna type GC content exon number start site end site
TU57811 True 208 lncRNA 0.42 2 32117889 32138685

Neighbor


gene id symbol gene type direction distance location
LOC120556662 samd3,LOC101476819 coding downstream 546108 31560616 ~ 31571781 (-)
LOC120557088 LOC107748254 coding downstream 649717 31451411 ~ 31468172 (-)
LOC120558255 NA coding downstream 717757 31400076 ~ 31400132 (-)
LOC120558244 NA coding downstream 719637 31398196 ~ 31398252 (-)
LOC120558242 NA coding downstream 721571 31396262 ~ 31396318 (-)
chd6 chd6,LOC102778367,LOC102308233,LOC101486676,LOC102201960 coding upstream 317582 32456267 ~ 32623525 (-)
mcm2 mcm2 coding upstream 646092 32784777 ~ 32800719 (-)
pigu pigu coding upstream 665477 32804162 ~ 32818975 (-)
tmem74b tmem74b,LOC102310340 coding upstream 708844 32847529 ~ 32859255 (-)
LOC120557780 rbl1 coding upstream 734431 32873116 ~ 32889435 (-)
G43017 NA non-coding downstream 149734 31809521 ~ 31968155 (-)
G43018 NA non-coding downstream 356456 31698779 ~ 31761433 (-)
LOC120556863 NA non-coding downstream 372465 31742142 ~ 31745424 (-)
G42976 NA non-coding downstream 560895 31556787 ~ 31556994 (-)
G42973 NA non-coding downstream 647040 31470645 ~ 31470849 (-)
LOC120557533 NA non-coding upstream 6908 32145593 ~ 32146710 (-)
G43035 NA non-coding upstream 141600 32280285 ~ 32281190 (-)
G43036 NA non-coding upstream 181584 32320269 ~ 32320484 (-)
LOC120556794 NA non-coding upstream 271557 32410242 ~ 32456243 (-)
G43060 NA non-coding upstream 302475 32441160 ~ 32456584 (-)
LOC120557755 grip2,LOC103357845,LOC102782189 other downstream 1102242 30946332 ~ 31015647 (-)
LOC120558045 NA other downstream 1438807 30638971 ~ 30679082 (-)
romo1 romo1,LOC102788570 other downstream 1987572 30125751 ~ 30130317 (-)
LOC120556842 rpp14,LOC102775666,LOC101465350,LOC103374991 other downstream 2080568 30036382 ~ 30037321 (-)
LOC120557442 hes5,LOC104956007 other downstream 3367656 28741798 ~ 28750233 (-)
LOC120557401 blcap other upstream 549335 32688020 ~ 32747110 (-)
podxl2 podxl2,LOC102777608 other upstream 612107 32750792 ~ 32783836 (-)
LOC120557803 NA other upstream 1049383 33188068 ~ 33223258 (-)
LOC120557840 svbp other upstream 1387812 33526497 ~ 33530867 (-)
LOC120557811 fam120a other upstream 1772695 33911380 ~ 33953932 (-)

Expression



Co-expression Network