G146949


Basic Information

Item Value
gene id G146949
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 3522327 ~ 3522546 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU166948
TGGATTCAACAGGTCCTGGAATGAAATCAAAGGTGTTAGCATGAACCAGAATCCTGGAGAGTAGGTGTAGACCTTTCCTCACACTGGTCATGTATGTTACATCTCTCTGTTCAGGCTGGAGATCGTTCCTCATCTAGTTCATTACCTCTCTTTTGCCCTTCTTTTCTCTGGCTTTGTGTTTTGGGCTGGTGGGAGTGTGTGCGTGCACGTGAGAAAGATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU166948 True 220 lncRNA 0.46 1 3522327 3522546

Neighbor

gene id symbol gene type direction distance location
CI01000028_03450349_03490905 NA coding downstream 30033 3449775 ~ 3492294 (-)
CI01000028_03307804_03308097 NA coding downstream 214011 3306644 ~ 3308316 (-)
CI01000028_03293038_03295110 NA coding downstream 226447 3293038 ~ 3295880 (-)
CI01000028_03264758_03280506 NA coding downstream 241821 3264519 ~ 3280506 (-)
CI01000028_03250213_03262711 DHX34 coding downstream 259616 3250121 ~ 3262711 (-)
CI01000028_03526529_03542023 NA coding upstream 3533 3526079 ~ 3542129 (-)
CI01000028_03573572_03578958 NA coding upstream 49592 3572138 ~ 3579082 (-)
CI01000028_03608674_03621881 NA coding upstream 85052 3607598 ~ 3621909 (-)
CI01000028_03628921_03634707 NA coding upstream 106144 3628690 ~ 3634879 (-)
CI01000028_03669254_03670964 NA coding upstream 146418 3668964 ~ 3671430 (-)
G146691 NA non-coding downstream 4865 3517252 ~ 3517462 (-)
G146688 NA non-coding downstream 6686 3515422 ~ 3515641 (-)
G146678 NA non-coding downstream 22218 3499857 ~ 3500109 (-)
G146625 NA non-coding downstream 88682 3433414 ~ 3433645 (-)
G146620 NA non-coding downstream 96022 3425936 ~ 3426305 (-)
G146975 NA non-coding upstream 45904 3568450 ~ 3568699 (-)
G147025 NA non-coding upstream 163205 3685751 ~ 3686505 (-)
G147027 NA non-coding upstream 173674 3696220 ~ 3697746 (-)
G147028 NA non-coding upstream 180938 3703484 ~ 3724594 (-)
G147139 NA non-coding upstream 314637 3837183 ~ 3837432 (-)
CI01000028_02441408_02445596 RPL35A, GM10247 other downstream 1076014 2441332 ~ 2445596 (-)
G146238 NA other downstream 1362289 2147378 ~ 2160038 (-)
G146190 NA other downstream 1411062 2097570 ~ 2111265 (-)
CI01000028_00474810_00475211 NA other downstream 3046981 473609 ~ 475211 (-)
G144855 NA other downstream 3386451 135392 ~ 137202 (-)
G149329 NA other upstream 3176967 6699513 ~ 6701240 (-)
CI01000028_06969947_06983352 NA other upstream 3448211 6965064 ~ 6984084 (-)
G149474 NA other upstream 3707245 7229791 ~ 7232783 (-)
CI01000028_07527725_07535631 ARPP19 other upstream 4003416 7525962 ~ 7535743 (-)
G149923 NA other upstream 4452022 7974568 ~ 8024244 (-)

Expression


Co-expression Network