RNA id: TU250720


Basic Information

Item Value
RNA id TU250720
length 312
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G185027
representative True

Chromosome Information

Item Value
chromosome id NC_035917.1
NCBI id CM008320.1
chromosome length 21661149
location 16832466 ~ 16832777 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

gtttgttagaggtgttaggagagtaagtgctctttgaagagctctgtcttcaggagtttattaaagatagtgagagattctcctgatctggtagtggaaggtagttagttagaggtgttaggagagtaaatgctctttgaagagctctgtcttcaggaatttcttaaagatagtgagagattctcctgatctggtagtggaaggtagttagttagaggtgttaggagagtaagtgctctttgaagagctctgtcttcaggaatttcttaaagatagtgagagattctcctgatctggtagtggaaggtagtt

Function

GO:

id name namespace
GO:0031667 response to nutrient levels biological_process
GO:0009991 response to extracellular stimulus biological_process
GO:0004982 N-formyl peptide receptor activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU250672 lncRNA downstream 128973 16647410 ~ 16703493 (-) True G184993
TU250695 lncRNA downstream 131158 16699724 ~ 16701308 (-) True G185012
TU250681 lncRNA downstream 150609 16677975 ~ 16681857 (-) True G185000
TU250679 lncRNA downstream 157457 16674125 ~ 16675009 (-) True G184998
TU250677 lncRNA downstream 174874 16655797 ~ 16657592 (-) True G184996
TU250726 lncRNA upstream 24614 16857391 ~ 16864206 (-) True G185033
TU250736 lncRNA upstream 88259 16921036 ~ 16922494 (-) True G185041
TU250777 lncRNA upstream 133232 16966009 ~ 16969764 (-) True G185073
TU250784 lncRNA upstream 199354 17032131 ~ 17032392 (-) True G185079
TU251055 lncRNA upstream 371964 17204741 ~ 17216109 (-) True G185280
XM_007232721.3 mRNA downstream 5112 16804577 ~ 16827354 (-) True gucy1a3
XM_007232722.3 mRNA downstream 33718 16765427 ~ 16798748 (-) True gucy1b3
XM_007232723.3 mRNA downstream 75567 16750652 ~ 16756899 (-) True fabp2
XM_015606673.2 mRNA downstream 476457 16351574 ~ 16356009 (-) False mab21l2
XM_022682016.1 mRNA downstream 476457 16351574 ~ 16356009 (-) True mab21l2
XM_007232754.3 mRNA upstream 38240 16871017 ~ 16874481 (-) True npy2r
XM_007230283.3 mRNA upstream 66273 16899050 ~ 16901684 (-) False lrat
XM_022682033.1 mRNA upstream 210098 17042875 ~ 17059662 (-) True fhdc1
XM_007230275.3 mRNA upstream 256377 17089154 ~ 17113139 (-) False LOC103033731
XM_022682035.1 mRNA upstream 256377 17089154 ~ 17113135 (-) False LOC103033731
trnar-ccu_39 other downstream 189735 16642659 ~ 16642731 (-) True trnar-ccu_39
trnaq-uug_3 other downstream 189863 16642531 ~ 16642603 (-) True trnaq-uug_3
trnar-ucg_17 other downstream 190221 16642173 ~ 16642245 (-) True trnar-ucg_17
trnar-acg_19 other downstream 190324 16642068 ~ 16642142 (-) True trnar-acg_19
trnar-ucg_16 other downstream 190428 16641966 ~ 16642038 (-) True trnar-ucg_16
XR_002651564.1 other upstream 65401 16898178 ~ 16901684 (-) True lrat
TU251079 other upstream 419490 17252267 ~ 17254633 (-) True G185295
TU251100 other upstream 462724 17295501 ~ 17300782 (-) True G185311
TU251103 other upstream 462724 17295501 ~ 17300281 (-) False G185311
TU251116 other upstream 497241 17330018 ~ 17331954 (-) False G185321

Expression Profile