RNA id: TCONS_00000102


Basic Information

Item Value
RNA id TCONS_00000102
length 560
RNA type processed_transcript
GC content 0.44
exon number 2
gene id XLOC_000050
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 2301958 ~ 2444210 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTACAGTCATGGCGTCCGGGAAGACGGTGGCTTTCCGCGCTATCCGCGAATAAGCGCCGAAAAACCCGTTTCACGCCACTTCAGCCGCCGCGCCGCGCGTTTTTTTCCAGCGGAATATCATTTAAAGACACCCTCGCGGACATATCAGCTCACAGCGAGTGCTCATTCAGCTTTTAAAGGGTTTAATCAATCGAGCCGCCGCCGCTGCCACGCGTCAGATCTTCTGAACATCAAACATTATTGCGGTAGCGCATCATCACTGTAGCGCTTTCTGCATAACTCCACAGATACTATGGTAAAACCACGTTTCGTCGATCACACTGAAAGTGCTGTAAGACTATCATTGAATAACGCCTGGAGTTTATTTAAATGGCTCTCCAAGGAATGCTCTGGCTCATGACCAACAACATAGTAGTTTTGTGTAATATAGTAAAACCACGTTTTTAGACTTGTATTTGGGAGTTATTACATAGCAATACACTATATAGTCACAGAAAAAGGTCACATTGGATTTCATAACCCTACAGAAGTGTATAATAATTCTGAATTGATCATACTA

Function

GO:

id name namespace
GO:0003094 glomerular filtration biological_process
GO:0005856 cytoskeleton cellular_component
GO:0005085 guanyl-nucleotide exchange factor activity molecular_function
GO:0001786 phosphatidylserine binding molecular_function
GO:0035091 phosphatidylinositol binding molecular_function
GO:1901981 phosphatidylinositol phosphate binding molecular_function
GO:0008092 cytoskeletal protein binding molecular_function

KEGG:

id description
ko01009 Protein phosphatases and associated proteins

ZFIN:

id description
ZDB-GENE-070424-163 Predicted to enable guanyl-nucleotide exchange factor activity; phosphatidylinositol phosphate binding activity; and phosphatidylserine binding activity. Acts upstream of or within glomerular filtration. Predicted to be located in cytoskeleton. Orthologous to human FARP1 (FERM, ARH/RhoGEF and pleckstrin domain protein 1).

Ensembl:

ensembl_id ENSDART00000143758

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00000101 lncRNA upstream 2412 2296591 ~ 2299546 (+) True XLOC_000048
TCONS_00002808 lncRNA upstream 278313 2023409 ~ 2023645 (+) True XLOC_000044
TCONS_00003015 lncRNA upstream 296326 2001716 ~ 2005632 (+) True XLOC_000043
TCONS_00000077 lncRNA upstream 402115 1898909 ~ 1899843 (+) True XLOC_000039
TCONS_00000073 lncRNA upstream 509435 1790772 ~ 1792523 (+) True XLOC_000036
TCONS_00003016 lncRNA downstream 1416043 3718666 ~ 3720603 (+) True XLOC_000053
TCONS_00000113 lncRNA downstream 2295437 4598060 ~ 4680477 (+) True XLOC_000056
TCONS_00002809 lncRNA downstream 2598837 4901460 ~ 5030155 (+) True XLOC_000057
TCONS_00003018 lncRNA downstream 3008856 5311479 ~ 5313595 (+) False XLOC_000059
TCONS_00003017 lncRNA downstream 3008856 5311479 ~ 5313595 (+) True XLOC_000059
TCONS_00000097 mRNA upstream 2405 2260407 ~ 2299553 (+) False XLOC_000048
TCONS_00000096 mRNA upstream 61839 2222363 ~ 2240119 (+) True XLOC_000047
TCONS_00000093 mRNA upstream 84097 2129175 ~ 2217861 (+) False XLOC_000046
TCONS_00000095 mRNA upstream 87558 2190714 ~ 2214400 (+) True XLOC_000046
TCONS_00000090 mRNA upstream 87641 2128970 ~ 2214317 (+) False XLOC_000046
TCONS_00000107 mRNA downstream 18761 2321384 ~ 2394768 (+) False XLOC_000050
TCONS_00000109 mRNA downstream 129333 2431956 ~ 2443772 (+) True XLOC_000050
TCONS_00000110 mRNA downstream 410333 2712956 ~ 3036019 (+) True XLOC_000052
TCONS_00000112 mRNA downstream 1799118 4101741 ~ 4154332 (+) True XLOC_000055
TCONS_00000114 mRNA downstream 2970858 5273481 ~ 5277583 (+) False XLOC_000058
TCONS_00000100 other upstream 2412 2286849 ~ 2299546 (+) False XLOC_000048
TCONS_00000098 other upstream 13185 2272261 ~ 2288773 (+) False XLOC_000048
TCONS_00000099 other upstream 26216 2275605 ~ 2275742 (+) True XLOC_000049
TCONS_00000094 other upstream 87561 2190700 ~ 2214397 (+) False XLOC_000046
TCONS_00000069 other upstream 508587 1718611 ~ 1793371 (+) False XLOC_000036
TCONS_00000108 other downstream 100480 2403103 ~ 2403224 (+) True XLOC_000051
TCONS_00000111 other downstream 1457301 3759924 ~ 3760034 (+) True XLOC_000054
TCONS_00000117 other downstream 3099911 5402534 ~ 5418507 (+) True XLOC_000060
TCONS_00000120 other downstream 3134767 5437390 ~ 5487162 (+) False XLOC_000062
TCONS_00000121 other downstream 3136120 5438743 ~ 5450444 (+) False XLOC_000062

Expression Profile

//