RNA id: TCONS_00000119


Basic Information

Item Value
RNA id TCONS_00000119
length 548
RNA type mRNA
GC content 0.46
exon number 3
gene id XLOC_000061
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 5422439 ~ 5434261 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTACAAATCCGTTGATAAAAGCATTAAACAAATAGCTAACAATACCTACTGTAAATCTGGATCTTTCGGGTCTCTCGTTGAAAACACTGCCTGCGAAACACAAACCAGCTGTTCTCGAAGACGCCACGTTTACTGCAGTCGACAATTCAAGTCAATGTGTGTAACAACAGTCGTGAATTAATTCACAAAAACATTACGGAGTAATTAGAGTTGTTTTACAGCAACTCGCTGAAGTCTAGGCTGACATGTTTTGAGCTCAACATCGCACGTCAAAAGGGGGAATAATATAAGGAGCAGTGCTTCTCCCCCACCAATGGTTGGTGTTAAGCGATGCTCCAGAGAAGATGGGCCAGGCTTTGTGTATCTGCTCTCGCAGTGCCATCACCATTGACAACAAGAGATACTACTTTGTTCAGAAACTAGAAGAAGGTGGTTTCAGCTATGTGGACCTGGTAGAAGGTGCGCACGATGGTCGTTTCTATGCTTTGAAGCGAATCCTCTGCCATGACCGCGAGGCCCGTAAGGAGGCGCAGACCGAGGTGGAGATG

Function

GO:

id name namespace
GO:0006468 protein phosphorylation biological_process
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0004672 protein kinase activity molecular_function

KEGG:

id description
ko01001 Protein kinases

ZFIN:

id description
ZDB-GENE-050417-102 Predicted to enable protein serine/threonine kinase activity. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in Golgi apparatus. Orthologous to human STK16 (serine/threonine kinase 16).

Ensembl:

ensembl_id ENSDART00000142248

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003018 lncRNA upstream 108981 5311479 ~ 5313595 (+) False XLOC_000059
TCONS_00003017 lncRNA upstream 108981 5311479 ~ 5313595 (+) True XLOC_000059
TCONS_00002809 lncRNA upstream 392421 4901460 ~ 5030155 (+) True XLOC_000057
TCONS_00000113 lncRNA upstream 742099 4598060 ~ 4680477 (+) True XLOC_000056
TCONS_00003016 lncRNA upstream 1701973 3718666 ~ 3720603 (+) True XLOC_000053
TCONS_00003019 lncRNA downstream 280264 5706970 ~ 5728684 (+) True XLOC_000064
TCONS_00003020 lncRNA downstream 368307 5795013 ~ 5799092 (+) False XLOC_000065
TCONS_00003021 lncRNA downstream 368329 5795035 ~ 5799092 (+) True XLOC_000065
TCONS_00000128 lncRNA downstream 735307 6162013 ~ 6166554 (+) False XLOC_000067
TCONS_00000131 lncRNA downstream 745137 6171843 ~ 6177337 (+) False XLOC_000067
TCONS_00000116 mRNA upstream 3460 5402476 ~ 5419116 (+) False XLOC_000060
TCONS_00000114 mRNA upstream 144993 5273481 ~ 5277583 (+) False XLOC_000058
TCONS_00000115 mRNA upstream 144999 5275811 ~ 5277577 (+) True XLOC_000058
TCONS_00000112 mRNA upstream 1268244 4101741 ~ 4154332 (+) True XLOC_000055
TCONS_00000110 mRNA upstream 2386557 2712956 ~ 3036019 (+) True XLOC_000052
TCONS_00000122 mRNA downstream 59093 5485799 ~ 5504130 (+) False XLOC_000062
TCONS_00000124 mRNA downstream 149445 5576151 ~ 5587575 (+) True XLOC_000063
TCONS_00000125 mRNA downstream 708470 6135176 ~ 6158609 (+) False XLOC_000066
TCONS_00000126 mRNA downstream 708482 6135188 ~ 6158609 (+) True XLOC_000066
TCONS_00000127 mRNA downstream 735224 6161930 ~ 6169817 (+) False XLOC_000067
TCONS_00000117 other upstream 4069 5402534 ~ 5418507 (+) True XLOC_000060
TCONS_00000111 other upstream 1662542 3759924 ~ 3760034 (+) True XLOC_000054
TCONS_00000104 other upstream 2980893 2301972 ~ 2441683 (+) False XLOC_000050
TCONS_00000108 other upstream 3019352 2403103 ~ 2403224 (+) True XLOC_000051
TCONS_00000102 other upstream 3119953 2301958 ~ 2302623 (+) False XLOC_000050
TCONS_00000120 other downstream 10684 5437390 ~ 5487162 (+) False XLOC_000062
TCONS_00000121 other downstream 12037 5438743 ~ 5450444 (+) False XLOC_000062
TCONS_00000123 other downstream 70579 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000134 other downstream 755636 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000149 other downstream 1360984 6787690 ~ 6787804 (+) True XLOC_000078

Expression Profile

//