RNA id: TCONS_00000128


Basic Information

Item Value
RNA id TCONS_00000128
length 666
lncRNA type retained_intron
GC content 0.46
exon number 4
gene id XLOC_000067
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 6161930 ~ 6185532 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGAGAGGGCGCTTCACGACGCCTTCCTTCGGCCTTTCTGTGTTTTTAGTCTTTTAAGATATATCTTGGAGGGCCAAAATGGACTTTGGCGATTTGTTTGACGAGCGGACGTTCACCTTTTCGGACTTTCAGGAGTTTACGTTTCTGCCTGAACATGAGCAGTGGTCAGAGAGAGTGAGGAAACGATTGTATTATGGTCTGGATTCTGACAGCACGCTGGATGCTCTATCATGCCCCATGACAGACATTGCTGTAGAACTGCTCCAGAAGTCTGCCCCAAGTCCCATTAGGAAGCTCCACAAGAAATACGCTGCACACGTGGCCAGGTGTGTTTAACTTCAAAACTGTGTCATTGTGCTACAACTAGATTTGATGAATATTCTCATGAGTAACAACACACCCTATTTTTGTTACAGGGAAGCATGTATCTCTCCCTGTGCTATGATGCTGGCCCTGATATACATTGAAAGACTGCGACACAGAAACCCGGAATACCTGCAACAGATCTCCTCCTCAGACCTCTTTTTGATATCAATGATGGTAGCCAGTAAATATTTGTATGATGAAGGAGAAGAGGAGGAGGTTTTCAACGATGAATGGGGTACTGCGGCCAAGCTGGACGTTCAGACTGTCAACACTCTGGAGATGAACTTCCTCAATGCGATTG

Function

GO:

id name namespace
GO:0000079 regulation of cyclin-dependent protein serine/threonine kinase activity biological_process
GO:0000307 cyclin-dependent protein kinase holoenzyme complex cellular_component
GO:0005634 nucleus cellular_component
GO:0016538 cyclin-dependent protein serine/threonine kinase regulator activity molecular_function
GO:0019901 protein kinase binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-6808 Predicted to enable cyclin-dependent protein serine/threonine kinase regulator activity. Predicted to be involved in regulation of cyclin-dependent protein serine/threonine kinase activity. Predicted to be part of cyclin-dependent protein kinase holoenzyme complex. Predicted to be active in nucleus. Orthologous to human CNPPD1 (cyclin Pas1/PHO80 domain containing 1).

Ensembl:

ensembl_id ENSDART00000144559

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003020 lncRNA upstream 362921 5795013 ~ 5799092 (+) False XLOC_000065
TCONS_00003021 lncRNA upstream 362921 5795035 ~ 5799092 (+) True XLOC_000065
TCONS_00003019 lncRNA upstream 433329 5706970 ~ 5728684 (+) True XLOC_000064
TCONS_00003018 lncRNA upstream 848418 5311479 ~ 5313595 (+) False XLOC_000059
TCONS_00003017 lncRNA upstream 848418 5311479 ~ 5313595 (+) True XLOC_000059
TCONS_00000131 lncRNA downstream 5289 6171843 ~ 6177337 (+) False XLOC_000067
TCONS_00000133 lncRNA downstream 6930 6173484 ~ 6179556 (+) False XLOC_000067
TCONS_00000135 lncRNA downstream 15790 6182344 ~ 6185532 (+) True XLOC_000067
TCONS_00000137 lncRNA downstream 23443 6189997 ~ 6196763 (+) False XLOC_000068
TCONS_00003022 lncRNA downstream 213324 6379878 ~ 6554470 (+) True XLOC_000072
TCONS_00000125 mRNA upstream 3404 6135176 ~ 6158609 (+) False XLOC_000066
TCONS_00000126 mRNA upstream 3404 6135188 ~ 6158609 (+) True XLOC_000066
TCONS_00000124 mRNA upstream 574438 5576151 ~ 5587575 (+) True XLOC_000063
TCONS_00000122 mRNA upstream 657883 5485799 ~ 5504130 (+) False XLOC_000062
TCONS_00000118 mRNA upstream 727752 5422439 ~ 5434261 (+) False XLOC_000061
TCONS_00000130 mRNA downstream 5031 6171585 ~ 6182518 (+) False XLOC_000067
TCONS_00000132 mRNA downstream 6232 6172786 ~ 6183228 (+) False XLOC_000067
TCONS_00000136 mRNA downstream 23395 6189949 ~ 6210718 (+) False XLOC_000068
TCONS_00000138 mRNA downstream 40396 6206950 ~ 6210718 (+) True XLOC_000068
TCONS_00000139 mRNA downstream 58939 6225493 ~ 6240518 (+) False XLOC_000069
TCONS_00000123 other upstream 659929 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000120 other upstream 674851 5437390 ~ 5487162 (+) False XLOC_000062
TCONS_00000121 other upstream 711569 5438743 ~ 5450444 (+) False XLOC_000062
TCONS_00000117 other upstream 743506 5402534 ~ 5418507 (+) True XLOC_000060
TCONS_00000111 other upstream 2401979 3759924 ~ 3760034 (+) True XLOC_000054
TCONS_00000134 other downstream 15788 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000149 other downstream 621136 6787690 ~ 6787804 (+) True XLOC_000078
TCONS_00000154 other downstream 897283 7063837 ~ 7063943 (+) True XLOC_000081
TCONS_00000208 other downstream 2987540 9154094 ~ 9155273 (+) False XLOC_000113
TCONS_00000209 other downstream 2988439 9154993 ~ 9155521 (+) False XLOC_000113

Expression Profile

//