RNA id: TCONS_00001508


Basic Information

Item Value
RNA id TCONS_00001508
length 662
RNA type mRNA
GC content 0.45
exon number 2
gene id XLOC_000947
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 2446996 ~ 2453185 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAACGTGAAAGCCGGAACTGCTTAAGTAACTGCCGAACGAAGTTTAGTTCGTCATGTTTGTCCGATGAAGATCAAACTTTCAGTGTGACTTTTAAATATAAAAGGATTTCCTAAATGTTCGGTCTTAGTCATGAACAGTACAATGAATACTACAGTCAGCATGAGCACCCATCATGTATTTGTGTACGGCTCACTAAAGAAAGGCCAGCCAAACCACCACGAACTCTTGAACTCTAACAATGGTCAAGCTGAGTTCATCACCTGCGCCCAGACCAAAGAGCCATACCCGCTGGTTATTGCCACCAAACACAACATTCCTTTTCTGCTGAATGTGCCCGGCTCTGGAAAGCAGGTCTCTGGTGAGATCTACAGCGTTGACCAGAAGATGCTGGAGTTCCTGGACTGGTTTGAGAAATGTCCAGACTGGTACCAGCGCACTTCCATCCAGCTGGAGATCCTAAAGGGGAATGGAGAATCTGGAAGAATTGAGGAGGCTTCTGTCTACAGCAAAATAAATTTTGAACCCGACTGGCTCAACAAGCCCACACATGAAAGTTATGATACCAATGGTGACCATGGACTGAAATTTGTGTGTCGAGAAGACAGGAAAGATGATTAACTTGTATATCTGGGTCTGTACCATGAAGCCAGATTAGCTCTCA

Function

GO:

id name namespace
GO:0042219 cellular modified amino acid catabolic process biological_process
GO:0005829 cytosol cellular_component
GO:0061929 gamma-glutamylaminecyclotransferase activity molecular_function
GO:0016829 lyase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070424-26 Predicted to enable gamma-glutamylaminecyclotransferase activity. Predicted to be involved in cellular modified amino acid catabolic process. Predicted to be active in cytosol. Orthologous to human GGACT (gamma-glutamylamine cyclotransferase).

Ensembl:

ensembl_id ENSDART00000152555

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003304 lncRNA downstream 197015 2239211 ~ 2251036 (-) True XLOC_000945
TCONS_00003303 lncRNA downstream 346790 2093996 ~ 2101261 (-) True XLOC_000944
TCONS_00003302 lncRNA downstream 351702 2093996 ~ 2096349 (-) False XLOC_000944
TCONS_00003301 lncRNA downstream 442516 2000666 ~ 2005535 (-) True XLOC_000940
TCONS_00003300 lncRNA downstream 442529 2000666 ~ 2005522 (-) False XLOC_000940
TCONS_00002901 lncRNA upstream 41836 2495021 ~ 2502744 (-) False XLOC_000949
TCONS_00003305 lncRNA upstream 44688 2497873 ~ 2502743 (-) True XLOC_000949
TCONS_00001511 lncRNA upstream 251419 2704604 ~ 2714275 (-) True XLOC_000950
TCONS_00003306 lncRNA upstream 843422 3296607 ~ 3299853 (-) False XLOC_000952
TCONS_00001519 lncRNA upstream 852364 3305549 ~ 3309194 (-) False XLOC_000953
TCONS_00001505 mRNA downstream 113797 2331637 ~ 2334254 (-) True XLOC_000946
TCONS_00001504 mRNA downstream 372522 2074513 ~ 2075529 (-) True XLOC_000943
TCONS_00001503 mRNA downstream 386632 2060430 ~ 2061419 (-) True XLOC_000942
TCONS_00001502 mRNA downstream 396452 2048047 ~ 2051599 (-) True XLOC_000941
TCONS_00001499 mRNA downstream 553329 1888541 ~ 1894722 (-) False XLOC_000939
TCONS_00001510 mRNA upstream 909 2454094 ~ 2457546 (-) True XLOC_000948
TCONS_00001512 mRNA upstream 647059 3100244 ~ 3295045 (-) True XLOC_000951
TCONS_00001524 mRNA upstream 2901304 5354489 ~ 5394752 (-) False XLOC_000963
TCONS_00001525 mRNA upstream 2910384 5363569 ~ 5394791 (-) True XLOC_000963
TCONS_00001526 mRNA upstream 2996592 5449777 ~ 5455502 (-) False XLOC_000964
TCONS_00001497 other downstream 519940 1884360 ~ 1928111 (-) False XLOC_000939
TCONS_00001500 other downstream 554046 1890171 ~ 1894005 (-) False XLOC_000939
TCONS_00001493 other downstream 562451 1874008 ~ 1885600 (-) False XLOC_000939
TCONS_00001492 other downstream 572933 1870861 ~ 1875118 (-) False XLOC_000939
TCONS_00001486 other downstream 1132298 1313605 ~ 1315753 (-) True XLOC_000932
TCONS_00001513 other upstream 844182 3297367 ~ 3297451 (-) False XLOC_000952
TCONS_00001514 other upstream 844299 3297484 ~ 3297570 (-) False XLOC_000952
TCONS_00001515 other upstream 844418 3297603 ~ 3297755 (-) False XLOC_000952
TCONS_00001516 other upstream 844663 3297848 ~ 3297936 (-) False XLOC_000952
TCONS_00001517 other upstream 844821 3298006 ~ 3298088 (-) False XLOC_000952

Expression Profile

//