Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU464098

Basic Information

Item	Value
RNA id	TU464098
length	223
lncRNA type	inter_gene
GC content	0.46
exon number	1
gene id	G403737
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000299
NCBI id	null
chromosome length	6567443
location	234040 ~ 234262 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

ATGTCCTGCTGTTTCTTGACCACAAATCACGCAGACAGCAAAAGAGCTCGATGGAAACTGCCGTAAATGACTCGTTAAGTCAAGGGAATTAAGGCTTGTTTTTTAATCGAAACGAACATCCTCGTCGGTCCGCGCGAAACGCGATTTGTCAGGCAACTGGTTTGGATTTTAACGCCGAACTCAAGTTAGTTTACCAAGAAGCTGGTCGTGCAACAAGCTGCTC

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU464043	lncRNA	downstream	71124	60302 ~ 162916 (-)	False	G403707
TU464136	lncRNA	upstream	5275	239537 ~ 239755 (-)	True	G403772
TU464099	lncRNA	upstream	5951	240213 ~ 240461 (-)	True	G403738
TU464137	lncRNA	upstream	6888	241150 ~ 242770 (-)	True	G403773
TU464138	lncRNA	upstream	8564	242826 ~ 243621 (-)	True	G403774
TU464139	lncRNA	upstream	9450	243712 ~ 244005 (-)	True	G403775
CI01000299_00185106_00209299.mRNA	mRNA	downstream	24741	184774 ~ 209299 (-)	True	CI01000299_00185106_00209299
CI01000299_00169255_00170695.mRNA	mRNA	downstream	63054	169223 ~ 170986 (-)	True	CI01000299_00169255_00170695
CI01000299_00448948_00449565.mRNA	mRNA	upstream	214601	448863 ~ 449757 (-)	True	CI01000299_00448948_00449565
CI01000299_00452374_00452868.mRNA	mRNA	upstream	217079	451341 ~ 452868 (-)	True	CI01000299_00452374_00452868
CI01000299_00670925_00672195.mRNA	mRNA	upstream	436418	670680 ~ 673625 (-)	False	CI01000299_00670925_00672195
CI01000299_01003547_01034507.mRNA	mRNA	upstream	769057	1003319 ~ 1034812 (-)	True	CI01000299_01003547_01034507
CI01000299_01057889_01063623.mRNA	mRNA	upstream	823558	1057820 ~ 1063623 (-)	True	CI01000299_01057889_01063623
TU464604	other	upstream	436572	670834 ~ 672856 (-)	True	CI01000299_00670925_00672195
TU464792	other	upstream	836345	1070607 ~ 1075891 (-)	True	G404372
TU465225	other	upstream	1425393	1659655 ~ 1660000 (-)	True	G404784
TU465428	other	upstream	1621377	1855639 ~ 1880988 (-)	True	G404976
TU465509	other	upstream	1783425	2017687 ~ 2018050 (-)	True	G405053

Expression Profile