RNA id: TCONS_00003317


Basic Information

Item Value
RNA id TCONS_00003317
length 220
lncRNA type sense_over
GC content 0.53
exon number 2
gene id XLOC_000967
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 5798548 ~ 6028876 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCAGCTGACAGCAGTGTTTGAAAAACTGGAGCTCCAGCAGAGGGCGCTAGTGAGTCCCGGGGGCAGTTTTGCATCCGGTCGCTCCAGTCCGGACCACTCTGAACCCGAACTCAACATCCTGCATCCGTACCTGAGCAGTGAGATAGAGGTCACTCCTTCTGCCCTCAAATCAACAACTTGCCACAGATGAGAACAAACGCAGCTTATATCCATCACAAAC

Function

GO:

id name namespace
GO:0045197 establishment or maintenance of epithelial cell apical/basal polarity biological_process
GO:0030010 establishment of cell polarity biological_process
GO:0000226 microtubule cytoskeleton organization biological_process
GO:0007155 cell adhesion biological_process
GO:0051660 establishment of centrosome localization biological_process
GO:0008104 protein localization biological_process
GO:0043296 apical junction complex cellular_component
GO:0005912 adherens junction cellular_component
GO:0005938 cell cortex cellular_component
GO:0016324 apical plasma membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0035091 phosphatidylinositol binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003316 lncRNA downstream 471667 5536338 ~ 5543063 (-) True XLOC_000965
TCONS_00001531 lncRNA downstream 503068 5509804 ~ 5511662 (-) False XLOC_000965
TCONS_00001530 lncRNA downstream 505145 5506524 ~ 5509585 (-) False XLOC_000965
TCONS_00003315 lncRNA downstream 662288 5350872 ~ 5352442 (-) True XLOC_000962
TCONS_00003314 lncRNA downstream 818009 5195698 ~ 5196721 (-) True XLOC_000961
TCONS_00003319 lncRNA upstream 35218 6060026 ~ 6085752 (-) False XLOC_000968
TCONS_00003320 lncRNA upstream 134823 6159631 ~ 6173701 (-) True XLOC_000969
TCONS_00003321 lncRNA upstream 196073 6220881 ~ 6225273 (-) False XLOC_000970
TCONS_00003322 lncRNA upstream 196073 6220881 ~ 6225285 (-) False XLOC_000970
TCONS_00001539 lncRNA upstream 196744 6221552 ~ 6225273 (-) False XLOC_000970
TCONS_00001533 mRNA downstream 268700 5606460 ~ 5746030 (-) False XLOC_000966
TCONS_00001534 mRNA downstream 269310 5728350 ~ 5745420 (-) True XLOC_000966
TCONS_00001529 mRNA downstream 471665 5504128 ~ 5543065 (-) False XLOC_000965
TCONS_00001528 mRNA downstream 472165 5504128 ~ 5542565 (-) False XLOC_000965
TCONS_00001532 mRNA downstream 472165 5536338 ~ 5542565 (-) False XLOC_000965
TCONS_00001536 mRNA upstream 43628 6068436 ~ 6085750 (-) True XLOC_000968
TCONS_00001537 mRNA upstream 193824 6218632 ~ 6225285 (-) False XLOC_000970
TCONS_00001541 mRNA upstream 378743 6403551 ~ 6494384 (-) True XLOC_000972
TCONS_00001544 mRNA upstream 1537508 7562316 ~ 7570181 (-) True XLOC_000976
TCONS_00001546 mRNA upstream 1549543 7574351 ~ 7603734 (-) False XLOC_000977
TCONS_00001523 other downstream 936242 5078371 ~ 5078488 (-) True XLOC_000959
TCONS_00001521 other downstream 1804078 4210498 ~ 4210652 (-) True XLOC_000957
TCONS_00001518 other downstream 2716481 3298112 ~ 3298249 (-) True XLOC_000952
TCONS_00001517 other downstream 2716642 3298006 ~ 3298088 (-) False XLOC_000952
TCONS_00001516 other downstream 2716794 3297848 ~ 3297936 (-) False XLOC_000952
TCONS_00001538 other upstream 196073 6220881 ~ 6222249 (-) False XLOC_000970
TCONS_00001542 other upstream 428596 6453404 ~ 6453519 (-) True XLOC_000973
TCONS_00001543 other upstream 1117231 7142039 ~ 7142143 (-) True XLOC_000974
TCONS_00001545 other upstream 1549543 7574351 ~ 7603573 (-) False XLOC_000977
TCONS_00001549 other upstream 1607311 7632119 ~ 7650072 (-) False XLOC_000978

Expression Profile

//