RNA id: TCONS_00001536


Basic Information

Item Value
RNA id TCONS_00001536
length 542
RNA type mRNA
GC content 0.46
exon number 2
gene id XLOC_000968
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 6060026 ~ 6085752 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCTCACTATCTGCAGCTTCCGGTTTCACTCTGGACTCCAGCGAGCGCGAACTCGGGAAAACCTTTCACTATCTCGACTTTTCTCGTGAACCCAGGACTGTTTACATCAGTTAAATGTGCAGTTTGGATTAAATACCGGACTCTTCTTTCACTCATGGATGTTATATCGGTTTACTCGAGGCTGTAGTAGCTCTTCAGAGAGGAGGAAGATCACCTGTAACAGTTGACCAATGACACCTGTTGTCTCTGCGGCGTTCGCTTTAAGAGAAGCTGCGATATAAACAAAGCCTCGAAGATATTTTAACGTTTAATGACGCATTTAAGATGAAGGTGACGGTCATTTTCGGGGAAACTAGAGTTGTCGTCCCGTGTAAGGACAGTTGGATGGTACGAGATTTGATCGATCAAGCTACTCAAAGATACAAGAAGATTGTTGAACAGGATGGGGAATTCCTGGTGCGGACGCTTCATGTGGAGTATGTGGACGGGGGGATCCTGGACCCAGATGACATGTTATCAGACCTGGTGGAGGACAAAGAAAAG

Function

GO:

id name namespace
GO:0000003 reproduction biological_process
GO:0022412 cellular process involved in reproduction in multicellular organism biological_process
GO:0022414 reproductive process biological_process
GO:0048477 oogenesis biological_process
GO:1905516 positive regulation of fertilization biological_process
GO:0035803 egg coat formation biological_process
GO:0043902 positive regulation of multi-organism process biological_process
GO:0035036 sperm-egg recognition biological_process
GO:0007276 gamete generation biological_process
GO:0080154 regulation of fertilization biological_process
GO:0007281 germ cell development biological_process
GO:2000241 regulation of reproductive process biological_process
GO:2000243 positive regulation of reproductive process biological_process
GO:0048609 multicellular organismal reproductive process biological_process
GO:0007339 binding of sperm to zona pellucida biological_process
GO:0007340 acrosome reaction biological_process
GO:0034587 piRNA metabolic process biological_process
GO:1990511 piRNA biosynthetic process biological_process
GO:0009988 cell-cell recognition biological_process
GO:2000344 positive regulation of acrosome reaction biological_process
GO:0032504 multicellular organism reproduction biological_process
GO:0060046 regulation of acrosome reaction biological_process
GO:0035804 structural constituent of egg coat molecular_function
GO:0019899 enzyme binding molecular_function
GO:0034584 piRNA binding molecular_function
GO:0032190 acrosin binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

ZFIN:

id description
ZDB-GENE-080225-12 Predicted to enable phosphatidylinositol binding activity. Predicted to be involved in several processes, including establishment of cell polarity; establishment of centrosome localization; and establishment or maintenance of epithelial cell apical/basal polarity. Predicted to be active in several cellular components, including adherens junction; apical junction complex; and apical plasma membrane. Is expressed in several structures, including EVL; intermediate cell mass of mesoderm; periderm; sensory system; and tegmentum. Orthologous to human PARD3B (par-3 family cell polarity regulator beta).

Ensembl:

ensembl_id ENSDART00000138891

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003317 lncRNA downstream 43628 6014730 ~ 6024808 (-) False XLOC_000967
TCONS_00003318 lncRNA downstream 43628 6021516 ~ 6024808 (-) True XLOC_000967
TCONS_00003316 lncRNA downstream 525373 5536338 ~ 5543063 (-) True XLOC_000965
TCONS_00001531 lncRNA downstream 556774 5509804 ~ 5511662 (-) False XLOC_000965
TCONS_00001530 lncRNA downstream 558851 5506524 ~ 5509585 (-) False XLOC_000965
TCONS_00003320 lncRNA upstream 73881 6159631 ~ 6173701 (-) True XLOC_000969
TCONS_00003321 lncRNA upstream 135131 6220881 ~ 6225273 (-) False XLOC_000970
TCONS_00003322 lncRNA upstream 135131 6220881 ~ 6225285 (-) False XLOC_000970
TCONS_00001539 lncRNA upstream 135802 6221552 ~ 6225273 (-) False XLOC_000970
TCONS_00001540 lncRNA upstream 135951 6221701 ~ 6225285 (-) True XLOC_000970
TCONS_00001535 mRNA downstream 39560 5798548 ~ 6028876 (-) False XLOC_000967
TCONS_00001533 mRNA downstream 322406 5606460 ~ 5746030 (-) False XLOC_000966
TCONS_00001534 mRNA downstream 323016 5728350 ~ 5745420 (-) True XLOC_000966
TCONS_00001529 mRNA downstream 525371 5504128 ~ 5543065 (-) False XLOC_000965
TCONS_00001528 mRNA downstream 525871 5504128 ~ 5542565 (-) False XLOC_000965
TCONS_00001537 mRNA upstream 132882 6218632 ~ 6225285 (-) False XLOC_000970
TCONS_00001541 mRNA upstream 317801 6403551 ~ 6494384 (-) True XLOC_000972
TCONS_00001544 mRNA upstream 1476566 7562316 ~ 7570181 (-) True XLOC_000976
TCONS_00001546 mRNA upstream 1488601 7574351 ~ 7603734 (-) False XLOC_000977
TCONS_00001547 mRNA upstream 1488697 7574447 ~ 7582859 (-) False XLOC_000977
TCONS_00001523 other downstream 989948 5078371 ~ 5078488 (-) True XLOC_000959
TCONS_00001521 other downstream 1857784 4210498 ~ 4210652 (-) True XLOC_000957
TCONS_00001518 other downstream 2770187 3298112 ~ 3298249 (-) True XLOC_000952
TCONS_00001517 other downstream 2770348 3298006 ~ 3298088 (-) False XLOC_000952
TCONS_00001516 other downstream 2770500 3297848 ~ 3297936 (-) False XLOC_000952
TCONS_00001538 other upstream 135131 6220881 ~ 6222249 (-) False XLOC_000970
TCONS_00001542 other upstream 367654 6453404 ~ 6453519 (-) True XLOC_000973
TCONS_00001543 other upstream 1056289 7142039 ~ 7142143 (-) True XLOC_000974
TCONS_00001545 other upstream 1488601 7574351 ~ 7603573 (-) False XLOC_000977
TCONS_00001549 other upstream 1546369 7632119 ~ 7650072 (-) False XLOC_000978

Expression Profile

//