RNA id: TU483187



Basic Information


Item Value
RNA id TU483187
length 200
lncRNA type inter_gene
GC content 0.32
exon number 1
gene id G420694
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 4807858 ~ 4808057 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ATATGAAGTAGAGATAAGAGATGCTGCTACAGCTTCATACGGCTGCATAGGACTGGTCATTGAACCAATTGGATTAAAAAAACATGTAGGTAAATAACACAAACAGACATTAAAAAGACTTCTGTATATGCGTAATAGATTTGCATAACGTGACAGAAAATATACTGAAACAAAATATAAATGTATGTCATGTATATAGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU483186 lncRNA upstream 14 4807364 ~ 4807844 (+) True G420693
TU483185 lncRNA upstream 639 4806806 ~ 4807219 (+) True G420692
TU483183 lncRNA upstream 5456 4802179 ~ 4802402 (+) True G420690
TU483180 lncRNA upstream 7291 4800236 ~ 4800567 (+) True G420687
TU483178 lncRNA upstream 8925 4798682 ~ 4798933 (+) True G420685
TU483107 lncRNA downstream 55326 4863383 ~ 4863859 (+) True G420615
TU483221 lncRNA downstream 63170 4871227 ~ 4873291 (+) True G420728
TU483034 lncRNA downstream 108078 4916135 ~ 4916905 (+) True G420542
TU483035 lncRNA downstream 111314 4919371 ~ 4922423 (+) True G420543
TU483053 lncRNA downstream 116152 4924209 ~ 4924509 (+) True G420561
CI01000304_04708075_04768393.mRNA mRNA upstream 39277 4707405 ~ 4768581 (+) True CI01000304_04708075_04768393
CI01000304_04687431_04705845.mRNA mRNA upstream 101916 4687431 ~ 4705942 (+) True CI01000304_04687431_04705845
CI01000304_04679406_04680031.mRNA mRNA upstream 127821 4679300 ~ 4680037 (+) True CI01000304_04679406_04680031
CI01000304_04650911_04659754.mRNA mRNA upstream 147402 4650911 ~ 4660456 (+) True CI01000304_04650911_04659754
CI01000304_04563922_04573450.mRNA mRNA upstream 234408 4563709 ~ 4573450 (+) True CI01000304_04563922_04573450
CI01000304_04866074_04866590.mRNA mRNA downstream 56929 4864986 ~ 4867070 (+) True CI01000304_04866074_04866590
CI01000304_04876496_04883240.mRNA mRNA downstream 68279 4876336 ~ 4883702 (+) True CI01000304_04876496_04883240
CI01000304_04902333_04911640.mRNA mRNA downstream 92158 4900215 ~ 4911778 (+) True CI01000304_04902333_04911640
CI01000304_04989817_04997932.mRNA mRNA downstream 180305 4988362 ~ 4997932 (+) True CI01000304_04989817_04997932
CI01000304_05085761_05095609.mRNA mRNA downstream 277539 5085596 ~ 5096251 (+) True CI01000304_05085761_05095609
TU482914 other upstream 504026 4303336 ~ 4303832 (+) True G420445
TU481280 other upstream 2714180 2092494 ~ 2093678 (+) True G418981
TU480282 other upstream 3932609 872670 ~ 875249 (+) True G418116
TU480224 other upstream 4243407 558092 ~ 564451 (+) True G418059
TU480131 other upstream 4580005 226703 ~ 227853 (+) True G417987
TU483012 other downstream 365166 5173223 ~ 5173339 (+) True G420524
TU483706 other downstream 1433176 6241233 ~ 6242997 (+) True G421162
TU483945 other downstream 2544592 7352649 ~ 7354332 (+) True CI01000304_07352697_07354032
TU484021 other downstream 2676084 7484141 ~ 7484688 (+) True G421435
TU485573 other downstream 3170571 7978628 ~ 7978814 (+) True G422786

Expression Profile


TU483187 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU483187 Expression in each Bioproject

Bar chart with 13 bars.
TU483187 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.