RNA id: TCONS_00000174


Basic Information

Item Value
RNA id TCONS_00000174
length 781
RNA type mRNA
GC content 0.49
exon number 1
gene id XLOC_000088
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 7679328 ~ 7683372 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAAAGAGTTTGTTAAGCGCGAGCTGTCACACGGGGCAGCGAGTCAGGGACTGCGGAGCATCGCGCGATGTATTGTCTGACATGAATAACGGGTGTGTTTTGACACTTGAAACGCCTTGATCGCGGAAAGCATTCCGATGCTATGACAGTCGCTTCTTTTAAGGTATTTCGTATACCTTTAATTTAACACTATAGACTGCATTCTTGTTTGTTGTTATCCGGATACTGTTCATTGCAACAAGTGGAATTTTGGTGTGCAGACCACGATCCAGCTGTCATGGACGAGCAAAAGGATCAAAATAGTCGTGATTCGACTGAGTCTGAGAGCGTCTCGCTCTCACCCAATATACCATCTCCTCCGATTTTACCTCACCAGGCTGCGCAGCAAGCCCACAGAACCACGAACTTTTTCATCGACAATATTTTAAGGCCAGATTTCGGCTGCAAGAAAGATCCTGGGAGTAGGGATCGGGCGCAAACGTCGGGTAGGGAGAATGTTAACCCAATGGTAATAAGGCCGTCGCATAATAGCAGTCTTTGCCAGGATTCAAACTGCAGTAGTGACAGCACTTCTTCGTCCTCGTCGTCTTCGCCATCCTCAAAGCAGTCCTCGGTAAAGCATTTCGAAGGAAATGGATCTACCGCAGCAAGGAACGGGGAGAATACGCCGTCGATAATGATGGTGAACGCCAACGGGGGAACTCCGCCAGCTAAAGAATCACAGCCTTTACTATGGCCTGCGTGGGTGTACTGCACCAGGTACTCGGACAGACCTTCATCTG

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0060385 axonogenesis involved in innervation biological_process
GO:0030182 neuron differentiation biological_process
GO:0007275 multicellular organism development biological_process
GO:0048663 neuron fate commitment biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-980526-6 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within axonogenesis involved in innervation and neuron fate commitment. Predicted to be active in nucleus. Is expressed in myoseptum; nervous system; neural tube; and somite. Human ortholog(s) of this gene implicated in Parkinson's disease. Orthologous to human EN1 (engrailed homeobox 1).

Ensembl:

ensembl_id ENSDART00000163488

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00002810 lncRNA upstream 5099 7672121 ~ 7674229 (+) True XLOC_000087
TCONS_00000171 lncRNA upstream 118474 7556999 ~ 7560854 (+) False XLOC_000086
TCONS_00000166 lncRNA upstream 125113 7546683 ~ 7554215 (+) True XLOC_000085
TCONS_00000161 lncRNA upstream 139612 7529853 ~ 7539716 (+) False XLOC_000085
TCONS_00000162 lncRNA upstream 139612 7538408 ~ 7539716 (+) False XLOC_000085
TCONS_00003026 lncRNA downstream 893669 8573777 ~ 8575057 (+) True XLOC_000097
TCONS_00000190 lncRNA downstream 895199 8575307 ~ 8577274 (+) True XLOC_000098
TCONS_00000192 lncRNA downstream 907122 8587230 ~ 8590636 (+) False XLOC_000100
TCONS_00003027 lncRNA downstream 907237 8587345 ~ 8590636 (+) False XLOC_000100
TCONS_00003028 lncRNA downstream 908124 8588232 ~ 8590636 (+) True XLOC_000100
TCONS_00000168 mRNA upstream 118106 7556965 ~ 7561222 (+) False XLOC_000086
TCONS_00000170 mRNA upstream 118107 7556977 ~ 7561221 (+) False XLOC_000086
TCONS_00000167 mRNA upstream 118194 7556965 ~ 7561134 (+) False XLOC_000086
TCONS_00000169 mRNA upstream 118257 7556977 ~ 7561071 (+) False XLOC_000086
TCONS_00000172 mRNA upstream 118314 7557018 ~ 7561014 (+) False XLOC_000086
TCONS_00000176 mRNA downstream 275922 7956030 ~ 7961696 (+) True XLOC_000089
TCONS_00000177 mRNA downstream 307944 7988052 ~ 7989314 (+) True XLOC_000090
TCONS_00000178 mRNA downstream 430454 8110562 ~ 8163167 (+) False XLOC_000091
TCONS_00000179 mRNA downstream 430901 8111009 ~ 8159970 (+) True XLOC_000091
TCONS_00000180 mRNA downstream 624796 8304904 ~ 8398249 (+) False XLOC_000092
TCONS_00000154 other upstream 615385 7063837 ~ 7063943 (+) True XLOC_000081
TCONS_00000149 other upstream 891524 6787690 ~ 6787804 (+) True XLOC_000078
TCONS_00000134 other upstream 1493796 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000123 other upstream 2177244 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000121 other upstream 2228884 5438743 ~ 5450444 (+) False XLOC_000062
TCONS_00000208 other downstream 1473986 9154094 ~ 9155273 (+) False XLOC_000113
TCONS_00000209 other downstream 1474885 9154993 ~ 9155521 (+) False XLOC_000113
TCONS_00000213 other downstream 1538540 9218648 ~ 9221616 (+) True XLOC_000115
TCONS_00000230 other downstream 2371666 10051774 ~ 10054771 (+) False XLOC_000126
TCONS_00000231 other downstream 2371676 10051784 ~ 10058057 (+) False XLOC_000126

Expression Profile

//