RNA id: TCONS_00021619


Basic Information

Item Value
RNA id TCONS_00021619
length 183
RNA type mRNA
GC content 0.47
exon number 2
gene id XLOC_011091
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 52526852 ~ 52540136 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCGAGATATATGAGACCTCCAAACACCTCCCTGTTCATCAGAAACATCTCCGACGACAGCAGGCCAGAGGATTTGCGTCGTGAGTTTGGTCGTTACGGGCCTATAGTAGATGTCTACATTCCTGTTGACTTCTATTCACGCCGACCAAGAGGATTTGCATACGTACAATATCCTTTGTAG

Function

GO:

id name namespace
GO:0016070 RNA metabolic process biological_process
GO:0016071 mRNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0000380 alternative mRNA splicing, via spliceosome biological_process
GO:0000381 regulation of alternative mRNA splicing, via spliceosome biological_process
GO:0006396 RNA processing biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0050684 regulation of mRNA processing biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0048024 regulation of mRNA splicing, via spliceosome biological_process
GO:1903311 regulation of mRNA metabolic process biological_process
GO:0043484 regulation of RNA splicing biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0008380 RNA splicing biological_process
GO:0005634 nucleus cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function
GO:0036002 pre-mRNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000188304

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021842 lncRNA downstream 589130 51897756 ~ 51947869 (-) False XLOC_011089
TCONS_00021841 lncRNA downstream 652705 51875371 ~ 51884294 (-) False XLOC_011088
TCONS_00022272 lncRNA downstream 1456569 51078667 ~ 51080430 (-) False XLOC_011080
TCONS_00022273 lncRNA downstream 1456569 51078915 ~ 51080430 (-) True XLOC_011080
TCONS_00022271 lncRNA downstream 3299898 49236408 ~ 49237101 (-) True XLOC_011064
TCONS_00021846 lncRNA upstream 16972 52557028 ~ 52562908 (-) True XLOC_011092
TCONS_00021847 lncRNA upstream 144702 52684758 ~ 52686317 (-) False XLOC_011093
TCONS_00021848 lncRNA upstream 145554 52685610 ~ 52688445 (-) True XLOC_011093
TCONS_00021624 lncRNA upstream 184524 52724580 ~ 52725361 (-) False XLOC_011094
TCONS_00021632 lncRNA upstream 707884 53247940 ~ 53254782 (-) True XLOC_011099
TCONS_00021618 mRNA downstream 570153 51950510 ~ 51966846 (-) True XLOC_011090
TCONS_00021616 mRNA downstream 647265 51885380 ~ 51889734 (-) True XLOC_011088
TCONS_00021615 mRNA downstream 648011 51883725 ~ 51888988 (-) False XLOC_011088
TCONS_00021613 mRNA downstream 1129474 51370106 ~ 51407525 (-) True XLOC_011086
TCONS_00021612 mRNA downstream 1237938 51292624 ~ 51299061 (-) True XLOC_011085
TCONS_00021620 mRNA upstream 2494 52542550 ~ 52646789 (-) False XLOC_011092
TCONS_00021621 mRNA upstream 166003 52706059 ~ 52728159 (-) False XLOC_011094
TCONS_00021622 mRNA upstream 167974 52708030 ~ 52733436 (-) False XLOC_011094
TCONS_00021623 mRNA upstream 168136 52708192 ~ 52733384 (-) False XLOC_011094
TCONS_00021625 mRNA upstream 184821 52724877 ~ 52736549 (-) True XLOC_011094
TCONS_00021617 other downstream 589218 51941830 ~ 51947781 (-) True XLOC_011089
TCONS_00021614 other downstream 781493 51755392 ~ 51755506 (-) True XLOC_011087
TCONS_00021604 other downstream 1575637 50961246 ~ 50961362 (-) True XLOC_011078
TCONS_00021603 other downstream 1601693 50935190 ~ 50935306 (-) True XLOC_011077
TCONS_00021599 other downstream 1898213 50638670 ~ 50638786 (-) True XLOC_011073
TCONS_00021634 other upstream 1102764 53642820 ~ 53649995 (-) True XLOC_011102
TCONS_00021635 other upstream 1110846 53650902 ~ 53655539 (-) True XLOC_011103
TCONS_00021650 other upstream 2225445 54765501 ~ 54767193 (-) True XLOC_011121
TCONS_00021653 other upstream 2245681 54785737 ~ 54786983 (-) False XLOC_011122

Expression Profile

//