RNA id: TCONS_00025839



Basic Information


Item Value
RNA id TCONS_00025839
length 844
RNA type mRNA
GC content 0.49
exon number 7
gene id XLOC_012976
representative True

Chromosome Information


Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 38900092 ~ 39042201 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GTTTTGCGTGGAGAGCTGCACAGTCTTAAGGAGGAGAACAACCGTCAGCAGCAGCTGTTGGCGCAGAACCTGCAACTACCTCCAGAGGCCAGGATTGAAGCCAGTCTACAGCACGAGATCACACGCCTCACCAACGAGAACCTGGAACTTCACTCTGATGATCCAAAGGAGTATAAAGCCTACAGAATCAGCATGTTACGCAGGATGGTTGATCTTATGGAGCAGTTGGAGAAACAGGACAAGACCGTTCGTAAGCTGAAGAAACAGCTCAAAGTATTTGCTAAGAAGATCAATGATCTGGAAGGGGGGCAGATGGACGTGTCTCCCGGACAAACGGCTGACGAGCCTGTTCATCCGGTGAACATTCCACGCAGAGAGAAAGATTTCCAGGGCATGCTGGAATACAAGAAAGAGGATGAACTCAAACTGGTCAAAAATATCATACTTGAGCTGAAGCCTCGTGGTGTTGCAGTGAATCTGATACCAGGTCTGCCCGCATACATCCTCTTCATGTGTCTGCGCCATGCTGACTACATCAACGATGACCAGAAAGTGCGATCTCTACTCACCTCCGTCATCAACAGCATCAAGAAGATCCTCAAGAAACGAGGTGATGACTTTGAGACTGTTTCCTTCTGGTTGGCCAACACATGTCGTTTTCTGCACTGCCTGAAACAGTACAGTGGTGATGAGCAATTCATGAAGCATAATAGCCCAAAGCAGAACGAACACTGTCTCTCTAACTTTGACCTGGCAGAGTACCGGCAGGTTCTGAGCGATCTGGCCATTCAGATCTACCAGCAGCTCATCAAGTGTATGGAAAACATCCTGCAGCCCATGATCG

Function


GO:

id name namespace
GO:0007015 actin filament organization biological_process
GO:0030050 vesicle transport along actin filament biological_process
GO:0016459 myosin complex cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0031982 vesicle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0000146 microfilament motor activity molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0051015 actin filament binding molecular_function
GO:0003774 motor activity molecular_function
GO:0003779 actin binding molecular_function
GO:0030898 actin-dependent ATPase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041027-2 Predicted to enable actin filament binding activity and microfilament motor activity. Predicted to be involved in actin filament organization and vesicle transport along actin filament. Predicted to be part of myosin complex. Predicted to be active in actin cytoskeleton; cytoplasm; and vesicle. Is expressed in central nervous system; dorsolateral placode; intestine; neural tube; and neuron neural crest derived. Human ortholog(s) of this gene implicated in Griscelli syndrome type 1. Orthologous to human MYO5A (myosin VA).

Ensembl:

ensembl_id ENSDART00000148428

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00027142 lncRNA upstream 273725 38748613 ~ 38754692 (+) False XLOC_012972
TCONS_00026925 lncRNA upstream 509614 38403325 ~ 38518803 (+) False XLOC_012971
TCONS_00027141 lncRNA upstream 509816 38489672 ~ 38518601 (+) True XLOC_012971
TCONS_00026924 lncRNA upstream 589792 38403325 ~ 38438625 (+) False XLOC_012971
TCONS_00025822 lncRNA upstream 820317 38206289 ~ 38208100 (+) True XLOC_012968
TCONS_00027143 lncRNA downstream 128696 39165363 ~ 39173192 (+) True XLOC_012980
TCONS_00027144 lncRNA downstream 584798 39621465 ~ 39632025 (+) False XLOC_012984
TCONS_00027145 lncRNA downstream 584807 39621474 ~ 39632025 (+) True XLOC_012984
TCONS_00026926 lncRNA downstream 1482069 40518736 ~ 40520628 (+) True XLOC_012994
TCONS_00027146 lncRNA downstream 1631400 40668067 ~ 40669736 (+) True XLOC_013002
TCONS_00025833 mRNA upstream 130753 38885309 ~ 38897664 (+) True XLOC_012975
TCONS_00025831 mRNA upstream 170805 38775277 ~ 38857612 (+) False XLOC_012974
TCONS_00025832 mRNA upstream 170805 38807239 ~ 38857612 (+) True XLOC_012974
TCONS_00025830 mRNA upstream 174478 38774584 ~ 38853939 (+) False XLOC_012974
TCONS_00025829 mRNA upstream 268166 38755024 ~ 38760251 (+) True XLOC_012973
TCONS_00025840 mRNA downstream 24020 39060687 ~ 39065115 (+) False XLOC_012977
TCONS_00025841 mRNA downstream 24146 39060813 ~ 39064810 (+) True XLOC_012977
TCONS_00025842 mRNA downstream 30908 39067575 ~ 39105519 (+) False XLOC_012978
TCONS_00025843 mRNA downstream 37472 39074139 ~ 39083437 (+) True XLOC_012978
TCONS_00025844 mRNA downstream 70055 39106722 ~ 39119005 (+) True XLOC_012979
TCONS_00025838 other upstream 33650 38985920 ~ 38994767 (+) False XLOC_012976
TCONS_00025819 other upstream 1010399 38017901 ~ 38018018 (+) True XLOC_012967
TCONS_00025818 other upstream 1065520 37962778 ~ 37962897 (+) True XLOC_012966
TCONS_00025817 other upstream 1569855 37458446 ~ 37458562 (+) True XLOC_012965
TCONS_00025815 other upstream 1767766 37259970 ~ 37260651 (+) True XLOC_012962
TCONS_00025852 other downstream 699722 39736389 ~ 39736503 (+) True XLOC_012986
TCONS_00025854 other downstream 987105 40023772 ~ 40023888 (+) True XLOC_012988
TCONS_00025863 other downstream 1430123 40466790 ~ 40466904 (+) True XLOC_012992
TCONS_00025872 other downstream 1596860 40633527 ~ 40636178 (+) True XLOC_013000
TCONS_00025882 other downstream 2475478 41512145 ~ 41526488 (+) False XLOC_013010

Expression Profile


//