RNA id: TCONS_00025870


Basic Information

Item Value
RNA id TCONS_00025870
length 429
RNA type mRNA
GC content 0.49
exon number 3
gene id XLOC_012999
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 40609153 ~ 40613189 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TGGAAGCGAAGAAATTAACCCAATTCAAGGAGAAATAGAGGAGCAATGGTTCAGAGGAAGCAAAGCAGAGTTTCTTCTGGCTGTGGCAGGAAATGTGGTTGGAGTGGGCAACGTGTGGAGGTTTTCCTTACCTCTGCTACAGGAATGGAGGATGGGCGTTCCTGATACCCTATCTGATGTTTGTGGTGACCTGTGGGGTTCCTCTGTTCCTGCTGGAGACAGCTATGGGACAGTTTACACAGCAAGGGGCCATTACATGCTGGCATCATCTCTGTCCACTAGCTGGGCGTATTGGATATGCAGGACAGCTAAAAGTGGTGTACGGCTGTATGTATTACATCATCATTCTGGCCTGGGCACTTTTCTACCTCATCTACTGCTTCAGCTCACAACTGCCATGGGCCAGCTGTGACAACATCTGGAACACAG

Function

GO:

id name namespace
GO:0006810 transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process
GO:0043005 neuron projection cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0042165 neurotransmitter binding molecular_function
GO:0015293 symporter activity molecular_function
GO:0005328 neurotransmitter molecular_function
GO:0005332 gamma-aminobutyric acid molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050419-207 Predicted to enable gamma-aminobutyric acid:sodium symporter activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Predicted to be integral component of plasma membrane.

Ensembl:

ensembl_id ENSDART00000146262

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00026926 lncRNA upstream 88525 40518736 ~ 40520628 (+) True XLOC_012994
TCONS_00027144 lncRNA upstream 977128 39621465 ~ 39632025 (+) False XLOC_012984
TCONS_00027145 lncRNA upstream 977128 39621474 ~ 39632025 (+) True XLOC_012984
TCONS_00027143 lncRNA upstream 1435961 39165363 ~ 39173192 (+) True XLOC_012980
TCONS_00027142 lncRNA upstream 1854461 38748613 ~ 38754692 (+) False XLOC_012972
TCONS_00027146 lncRNA downstream 54878 40668067 ~ 40669736 (+) True XLOC_013002
TCONS_00027147 lncRNA downstream 147452 40760641 ~ 40763051 (+) True XLOC_013003
TCONS_00027148 lncRNA downstream 288709 40901898 ~ 40902607 (+) True XLOC_013004
TCONS_00027149 lncRNA downstream 575550 41188739 ~ 41193714 (+) False XLOC_013006
TCONS_00026927 lncRNA downstream 575601 41188790 ~ 41227202 (+) False XLOC_013006
TCONS_00025869 mRNA upstream 4790 40584288 ~ 40604363 (+) True XLOC_012998
TCONS_00025868 mRNA upstream 26049 40572294 ~ 40583104 (+) True XLOC_012997
TCONS_00025867 mRNA upstream 43377 40552620 ~ 40565776 (+) True XLOC_012996
TCONS_00025866 mRNA upstream 68450 40525408 ~ 40540703 (+) True XLOC_012995
TCONS_00025865 mRNA upstream 131288 40471826 ~ 40477865 (+) True XLOC_012993
TCONS_00025871 mRNA downstream 4528 40617717 ~ 40638096 (+) False XLOC_013000
TCONS_00025873 mRNA downstream 30471 40643660 ~ 40660847 (+) True XLOC_013001
TCONS_00025874 mRNA downstream 380007 40993196 ~ 41051768 (+) False XLOC_013005
TCONS_00025875 mRNA downstream 380180 40993369 ~ 41047681 (+) True XLOC_013005
TCONS_00025876 mRNA downstream 619530 41232719 ~ 41251084 (+) False XLOC_013007
TCONS_00025863 other upstream 142249 40466790 ~ 40466904 (+) True XLOC_012992
TCONS_00025854 other upstream 585265 40023772 ~ 40023888 (+) True XLOC_012988
TCONS_00025852 other upstream 872650 39736389 ~ 39736503 (+) True XLOC_012986
TCONS_00025838 other upstream 1614386 38985920 ~ 38994767 (+) False XLOC_012976
TCONS_00025819 other upstream 2591135 38017901 ~ 38018018 (+) True XLOC_012967
TCONS_00025872 other downstream 20338 40633527 ~ 40636178 (+) True XLOC_013000
TCONS_00025882 other downstream 898956 41512145 ~ 41526488 (+) False XLOC_013010
TCONS_00025883 other downstream 898970 41512159 ~ 41520460 (+) False XLOC_013010
TCONS_00025892 other downstream 969602 41582791 ~ 41585575 (+) True XLOC_013014
TCONS_00025893 other downstream 1044298 41657487 ~ 41659824 (+) True XLOC_013015