RNA id: TCONS_00025876


Basic Information

Item Value
RNA id TCONS_00025876
length 258
RNA type mRNA
GC content 0.54
exon number 3
gene id XLOC_013007
representative False

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 41232719 ~ 41310976 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCGCAGGTCGCTCAGCTGATGAAGGTAAAGCTGCTACTGCTGCACTGTGTCTAACAGCAACTACAACACTGGAACAAATAGGCTGCTGGTTGGGGCATTTGCACACGGCTGTGAATGGTAGTGTCTAGAAAGGGTATGTCCCTTCAGGAGAGAGGTGCCAATGTCCAACCGGCCTAATTCCAATCCAGGGGGGTCACTGCGCCGTTCACAGAGGAACACAGCCGCGGCCCAGCCAATAGACCACACACTTGCAGGAAG

Function

GO:

id name namespace
GO:0045995 regulation of embryonic development biological_process
GO:0006974 cellular response to DNA damage stimulus biological_process
GO:1901315 negative regulation of histone H2A K63-linked ubiquitination biological_process
GO:2000780 negative regulation of double-strand break repair biological_process
GO:0006511 ubiquitin-dependent protein catabolic process biological_process
GO:0005654 nucleoplasm cellular_component
GO:0016740 transferase activity molecular_function
GO:0004842 ubiquitin-protein transferase activity molecular_function
GO:0008270 zinc ion binding molecular_function
GO:0061630 ubiquitin protein ligase activity molecular_function

KEGG:

id description
ko04120 Ubiquitin mediated proteolysis
ko04121 Ubiquitin system

ZFIN:

id description
ZDB-GENE-041111-262 Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in several processes, including cellular protein metabolic process; negative regulation of nitrogen compound metabolic process; and regulation of embryonic development. Predicted to act upstream of or within DNA repair. Predicted to be located in nucleoplasm. Is expressed in myotome. Human ortholog(s) of this gene implicated in Clark-Baraitser syndrome. Orthologous to human TRIP12 (thyroid hormone receptor interactor 12).

Ensembl:

ensembl_id ENSDART00000138552

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00026927 lncRNA upstream 5517 41188790 ~ 41227202 (+) False XLOC_013006
TCONS_00026928 lncRNA upstream 5517 41188827 ~ 41227202 (+) True XLOC_013006
TCONS_00027149 lncRNA upstream 39005 41188739 ~ 41193714 (+) False XLOC_013006
TCONS_00027148 lncRNA upstream 330112 40901898 ~ 40902607 (+) True XLOC_013004
TCONS_00027147 lncRNA upstream 469668 40760641 ~ 40763051 (+) True XLOC_013003
TCONS_00025881 lncRNA downstream 261018 41512102 ~ 41526488 (+) False XLOC_013010
TCONS_00025885 lncRNA downstream 269076 41520160 ~ 41526488 (+) False XLOC_013010
TCONS_00025886 lncRNA downstream 269694 41520778 ~ 41522512 (+) True XLOC_013010
TCONS_00027150 lncRNA downstream 820644 42071728 ~ 42077328 (+) False XLOC_013021
TCONS_00027151 lncRNA downstream 820647 42071731 ~ 42091211 (+) True XLOC_013021
TCONS_00025874 mRNA upstream 180951 40993196 ~ 41051768 (+) False XLOC_013005
TCONS_00025875 mRNA upstream 185038 40993369 ~ 41047681 (+) True XLOC_013005
TCONS_00025873 mRNA upstream 571872 40643660 ~ 40660847 (+) True XLOC_013001
TCONS_00025871 mRNA upstream 594623 40617717 ~ 40638096 (+) False XLOC_013000
TCONS_00025870 mRNA upstream 619530 40609153 ~ 40613189 (+) True XLOC_012999
TCONS_00025879 mRNA downstream 62915 41313999 ~ 41465606 (+) True XLOC_013008
TCONS_00025880 mRNA downstream 244757 41495841 ~ 41509800 (+) True XLOC_013009
TCONS_00025884 mRNA downstream 261101 41512185 ~ 41526488 (+) False XLOC_013010
TCONS_00025887 mRNA downstream 276793 41527877 ~ 41539256 (+) True XLOC_013011
TCONS_00025888 mRNA downstream 291458 41542542 ~ 41547318 (+) True XLOC_013012
TCONS_00025872 other upstream 596541 40633527 ~ 40636178 (+) True XLOC_013000
TCONS_00025863 other upstream 765815 40466790 ~ 40466904 (+) True XLOC_012992
TCONS_00025854 other upstream 1208831 40023772 ~ 40023888 (+) True XLOC_012988
TCONS_00025852 other upstream 1496216 39736389 ~ 39736503 (+) True XLOC_012986
TCONS_00025838 other upstream 2237952 38985920 ~ 38994767 (+) False XLOC_012976
TCONS_00025882 other downstream 261061 41512145 ~ 41526488 (+) False XLOC_013010
TCONS_00025883 other downstream 261075 41512159 ~ 41520460 (+) False XLOC_013010
TCONS_00025892 other downstream 331707 41582791 ~ 41585575 (+) True XLOC_013014
TCONS_00025893 other downstream 406403 41657487 ~ 41659824 (+) True XLOC_013015
TCONS_00025894 other downstream 417100 41668184 ~ 41668309 (+) True XLOC_013016

Expression Profile

//