RNA id: TCONS_00036472


Basic Information

Item Value
RNA id TCONS_00036472
length 438
lncRNA type sense_over
GC content 0.46
exon number 3
gene id XLOC_018059
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 23160512 ~ 23171430 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTGTCCTTCTACAGCTATATTTCCTTAAACCGAGAAGACTAGCAAACCGTTGCTACAACTAAAAGCGCGTCCATGGTTTCAGTGAAAGTCAAGGGAGTGAATGGTGGCTTTTACTAGCAGTATAAATACAACGCGCGCACCCGCGCCGCTGGATTTAGTGCACTGGGACGTCCTGTAGCAGGATTACAGCAGCAGATCCGCAACCATGGCTGACACTTTGAGAAGACTAGTGAACTCCTCTCCGTACAGTGTATTGCAGGACAAACTAGACGCTTGGTACAAAGACTATCATGTTTATTCGTGTGACCAGAACCTAAATAGGTGCTGTGAACTAGTCGAGCTTACCTCAAAAATACAGGGTCAATTGTTCACCATACTCAACCTTACAGCACAAGAGGGTGGACATTATTCAGGAGTCGACACACTGAAATCTCGCCT

Function

GO:

id name namespace
GO:0006974 cellular response to DNA damage stimulus biological_process
GO:0048545 response to steroid hormone biological_process
GO:0035694 mitochondrial protein catabolic process biological_process
GO:0035695 mitophagy by induced vacuole formation biological_process
GO:0016020 membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005739 mitochondrion cellular_component
GO:0005741 mitochondrial outer membrane cellular_component
GO:0003674 molecular_function molecular_function

KEGG:

id description
ko04131 Membrane trafficking

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036835 lncRNA downstream 215 23160676 ~ 23168968 (-) False XLOC_018059
TCONS_00035585 lncRNA downstream 5605 23160676 ~ 23163578 (-) False XLOC_018059
TCONS_00035584 lncRNA downstream 5609 23160676 ~ 23163574 (-) False XLOC_018059
TCONS_00035587 lncRNA downstream 5770 23161438 ~ 23163413 (-) False XLOC_018059
TCONS_00036834 lncRNA downstream 9685 23157083 ~ 23159498 (-) True XLOC_018058
TCONS_00036473 lncRNA upstream 23429 23194788 ~ 23196658 (-) True XLOC_018060
TCONS_00035600 lncRNA upstream 309094 23480453 ~ 23488144 (-) False XLOC_018066
TCONS_00036836 lncRNA upstream 737235 23908594 ~ 23946098 (-) True XLOC_018071
TCONS_00035610 lncRNA upstream 893330 24064689 ~ 24122757 (-) False XLOC_018072
TCONS_00035615 lncRNA upstream 981319 24152678 ~ 24159764 (-) False XLOC_018073
TCONS_00035578 mRNA downstream 127908 22869608 ~ 23041275 (-) True XLOC_018053
TCONS_00035580 mRNA downstream 142960 23022985 ~ 23026223 (-) True XLOC_018055
TCONS_00035576 mRNA downstream 370389 22739792 ~ 22798794 (-) False XLOC_018052
TCONS_00035577 mRNA downstream 390789 22756556 ~ 22778394 (-) True XLOC_018052
TCONS_00035575 mRNA downstream 684562 22483048 ~ 22484621 (-) True XLOC_018050
TCONS_00035588 mRNA upstream 32587 23203946 ~ 23226453 (-) False XLOC_018061
TCONS_00035589 mRNA upstream 34775 23206134 ~ 23219964 (-) False XLOC_018061
TCONS_00035591 mRNA upstream 74261 23245620 ~ 23253630 (-) False XLOC_018062
TCONS_00035592 mRNA upstream 74261 23245620 ~ 23254876 (-) False XLOC_018062
TCONS_00035594 mRNA upstream 252455 23423814 ~ 23426339 (-) False XLOC_018063
TCONS_00035586 other downstream 5926 23161279 ~ 23163257 (-) False XLOC_018059
TCONS_00035582 other downstream 86993 23082069 ~ 23082190 (-) False XLOC_018056
TCONS_00035581 other downstream 87387 23081660 ~ 23081796 (-) True XLOC_018057
TCONS_00035579 other downstream 258871 22910198 ~ 22910312 (-) True XLOC_018054
TCONS_00035566 other downstream 1259049 21897971 ~ 21910134 (-) True XLOC_018042
TCONS_00035590 other upstream 52541 23223900 ~ 23226376 (-) True XLOC_018061
TCONS_00035593 other upstream 74280 23245639 ~ 23248639 (-) True XLOC_018062
TCONS_00035595 other upstream 252487 23423846 ~ 23425654 (-) True XLOC_018063
TCONS_00035611 other upstream 911780 24083139 ~ 24122757 (-) True XLOC_018072
TCONS_00035616 other upstream 981440 24152799 ~ 24172140 (-) False XLOC_018073

Expression Profile

//