RNA id: TCONS_00043695


Basic Information

Item Value
RNA id TCONS_00043695
length 788
RNA type mRNA
GC content 0.53
exon number 1
gene id XLOC_022114
representative False

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 4929442 ~ 4975517 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCTGTTTCTGCAGGACTAGTGCCCATGAGGTCGTTGACGCTGGTCCTGCTCATCCTGATCAGCATTCAGGCTGCACTCATTATGGGAGGCCACACCCAGGCACAGGCGTCAGCCAATCAGCACGCGGCAACACAAAACTCACCCAGGCTTTACAGCCAATCAAAAGAGGACTTGCACTATGACGAACTAATTCCCACCGTGGACCCCAAACTCTTCAACAAGCGCCGCTACCGCTCACCTCGTGTAGTGTTTAGTGATGTGATCACTGCTGAAAAAGAAATGGGAACCCCCAGGCGTCCACGCATCCGACGGAAGGCAAACGACTTCCTGCATCGTGGTGAGTACTCGGTGTGTGACAGCGAAGAGCACTGGGTTGGCAACCTGACCCATGCCACAGACTTAGGGGGCAATGAAGTCATGGTGCTACCACATTTTCGCATCAACAACGTTGTAAAGAAGCAGCTCTTCTACGAGACCACATGTCGTGTGAAGAAACCTATTGGCGCCCCTAAGCCCGGTCAAGGAGCCAGTGGCGTTAAAGCAGGAACCTCTAGCTGTCGTGGCATTGACAGCAAGCACTGGAACTCTTACTGCACCAACACACACACCTATGTGCGGGCGCTAACGTCCTACAAAAACCAGATCGCCTGGAGGTTCATCCGAATCAACGCCGCATGCGTCTGTGTGCTCAGCCGTAACTCCTGGAGGCATGGACTGAAGTATTGACTGCTATCTCAGCAATCCAATGCAGCCTCCTGTTGAAAGTCCCTTTCACCCATCATTATTAT

Function

GO:

id name namespace
GO:0033138 positive regulation of peptidyl-serine phosphorylation biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0007613 memory biological_process
GO:0021675 nerve development biological_process
GO:0038180 nerve growth factor signaling pathway biological_process
GO:0048672 positive regulation of collateral sprouting biological_process
GO:0050804 modulation of chemical synaptic transmission biological_process
GO:0045664 regulation of neuron differentiation biological_process
GO:0007422 peripheral nervous system development biological_process
GO:0043524 negative regulation of neuron apoptotic process biological_process
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway biological_process
GO:0030424 axon cellular_component
GO:0030425 dendrite cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0031410 cytoplasmic vesicle cellular_component
GO:0008021 synaptic vesicle cellular_component
GO:0005102 signaling receptor binding molecular_function
GO:0005163 nerve growth factor receptor binding molecular_function
GO:0008083 growth factor activity molecular_function

KEGG:

id description
ko04010 MAPK signaling pathway
ko04014 Ras signaling pathway
ko04015 Rap1 signaling pathway
ko04020 Calcium signaling pathway
ko04151 PI3K-Akt signaling pathway
ko04060 Cytokine-cytokine receptor interaction
ko04750 Inflammatory mediator regulation of TRP channels
ko04052 Cytokines and growth factors

ZFIN:

id description
ZDB-GENE-990415-176 Predicted to enable growth factor activity and nerve growth factor receptor binding activity. Predicted to be involved in several processes, including cell surface receptor signaling pathway; nervous system development; and positive regulation of peptidyl-serine phosphorylation. Predicted to be located in extracellular region. Predicted to be active in several cellular components, including axon; dendrite; and synaptic vesicle. Is expressed in otic vesicle. Human ortholog(s) of this gene implicated in several diseases, including IgA glomerulonephritis; end stage renal disease; hereditary sensory and autonomic neuropathy type 5; interstitial cystitis; and neurogenic bladder. Orthologous to human NGF (nerve growth factor).

Ensembl:

ensembl_id ENSDART00000189456

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00043692 lncRNA downstream 3833 4917916 ~ 4925609 (-) False XLOC_022113
TCONS_00043691 lncRNA downstream 4311 4916969 ~ 4925131 (-) False XLOC_022113
TCONS_00043693 lncRNA downstream 4311 4918398 ~ 4925131 (-) False XLOC_022113
TCONS_00043668 lncRNA downstream 1169985 3752862 ~ 3759457 (-) False XLOC_022103
TCONS_00043672 lncRNA downstream 1170006 3757789 ~ 3759436 (-) True XLOC_022103
TCONS_00043704 lncRNA upstream 189503 5119732 ~ 5126166 (-) True XLOC_022117
TCONS_00044713 lncRNA upstream 260548 5190777 ~ 5199754 (-) True XLOC_022118
TCONS_00044945 lncRNA upstream 1383353 6313582 ~ 6324914 (-) True XLOC_022127
TCONS_00044946 lncRNA upstream 1398002 6328231 ~ 6347320 (-) False XLOC_022128
TCONS_00043720 lncRNA upstream 1469610 6399839 ~ 6403536 (-) False XLOC_022129
TCONS_00043687 mRNA downstream 3718 4915595 ~ 4925724 (-) False XLOC_022113
TCONS_00043688 mRNA downstream 3801 4915966 ~ 4925641 (-) False XLOC_022113
TCONS_00043694 mRNA downstream 4311 4918462 ~ 4925131 (-) True XLOC_022113
TCONS_00043686 mRNA downstream 14324 4899238 ~ 4915118 (-) True XLOC_022112
TCONS_00043685 mRNA downstream 74320 4834447 ~ 4855122 (-) True XLOC_022111
TCONS_00043702 mRNA upstream 79735 5009964 ~ 5032587 (-) True XLOC_022115
TCONS_00043703 mRNA upstream 156088 5086317 ~ 5101847 (-) True XLOC_022116
TCONS_00043709 mRNA upstream 722995 5653224 ~ 5685172 (-) False XLOC_022122
TCONS_00043711 mRNA upstream 723144 5653373 ~ 5683147 (-) False XLOC_022122
TCONS_00043710 mRNA upstream 723144 5653373 ~ 5683147 (-) False XLOC_022122
TCONS_00043689 other downstream 3817 4916905 ~ 4925625 (-) False XLOC_022113
TCONS_00043690 other downstream 3819 4916955 ~ 4925623 (-) False XLOC_022113
TCONS_00043654 other downstream 1873346 3055981 ~ 3056096 (-) True XLOC_022096
TCONS_00043637 other downstream 3710941 1218382 ~ 1218501 (-) True XLOC_022077
TCONS_00043618 other downstream 4308356 618553 ~ 621086 (-) True XLOC_022061
TCONS_00043705 other upstream 280792 5211021 ~ 5365184 (-) False XLOC_022119
TCONS_00043706 other upstream 370050 5300279 ~ 5365345 (-) True XLOC_022119
TCONS_00043707 other upstream 500967 5431196 ~ 5431319 (-) True XLOC_022120
TCONS_00043708 other upstream 501189 5431418 ~ 5431517 (-) True XLOC_022121
TCONS_00043740 other upstream 2031291 6961520 ~ 6982874 (-) False XLOC_022140

Expression Profile

//