RNA id: TCONS_00043747


Basic Information

Item Value
RNA id TCONS_00043747
length 84
RNA type miRNA
GC content 0.40
exon number 1
gene id XLOC_022144
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 7170866 ~ 7217574 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AATGCTTTGCTAAAGCTGGTAAAATGGAACCAAATCAACTGTTTTATGGATTTGGTCCCCTTCAACCAGCTGTAGCTGTGCATT

Function

GO:

id name namespace
GO:0048468 cell development biological_process
GO:0050879 multicellular organismal movement biological_process
GO:0050881 musculoskeletal movement biological_process
GO:0007517 muscle organ development biological_process
GO:0007519 skeletal muscle tissue development biological_process
GO:0006936 muscle contraction biological_process
GO:0030154 cell differentiation biological_process
GO:0006941 striated muscle contraction biological_process
GO:0048856 anatomical structure development biological_process
GO:0016203 muscle attachment biological_process
GO:0048869 cellular developmental process biological_process
GO:0050746 regulation of lipoprotein metabolic process biological_process
GO:0050748 negative regulation of lipoprotein metabolic process biological_process
GO:0006500 N-terminal protein palmitoylation biological_process
GO:0060254 regulation of N-terminal protein palmitoylation biological_process
GO:0060262 negative regulation of N-terminal protein palmitoylation biological_process
GO:0003008 system process biological_process
GO:0003009 skeletal muscle contraction biological_process
GO:0003012 muscle system process biological_process
GO:0003015 heart process biological_process
GO:0061061 muscle structure development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0032502 developmental process biological_process
GO:0060537 muscle tissue development biological_process
GO:0060538 skeletal muscle organ development biological_process
GO:1903059 regulation of protein lipidation biological_process
GO:1903060 negative regulation of protein lipidation biological_process
GO:0014706 striated muscle tissue development biological_process
GO:0060047 heart contraction biological_process
GO:0099080 supramolecular complex cellular_component
GO:0099081 supramolecular polymer cellular_component
GO:0043292 contractile fiber cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0031012 extracellular matrix cellular_component
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0016528 sarcoplasm cellular_component
GO:0016529 sarcoplasmic reticulum cellular_component
GO:0005593 FACIT collagen trimer cellular_component
GO:0005594 collagen type IX trimer cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0005604 basement membrane cellular_component
GO:0099512 supramolecular fiber cellular_component
GO:0031674 I band cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component
GO:0003779 actin binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000116854

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00043742 lncRNA downstream 174437 6984672 ~ 6997683 (-) True XLOC_022141
TCONS_00043734 lncRNA downstream 306158 6856469 ~ 6865962 (-) True XLOC_022137
TCONS_00043728 lncRNA downstream 484934 6680809 ~ 6687186 (-) False XLOC_022133
TCONS_00044714 lncRNA downstream 752270 6409743 ~ 6419850 (-) True XLOC_022129
TCONS_00043721 lncRNA downstream 761368 6403207 ~ 6410752 (-) False XLOC_022129
TCONS_00044949 lncRNA upstream 28040 7200243 ~ 7202861 (-) True XLOC_022145
TCONS_00044950 lncRNA upstream 137360 7309563 ~ 7323879 (-) True XLOC_022147
TCONS_00044951 lncRNA upstream 247607 7419810 ~ 7428593 (-) True XLOC_022148
TCONS_00044952 lncRNA upstream 560936 7733139 ~ 7735392 (-) True XLOC_022151
TCONS_00043760 lncRNA upstream 777882 7950085 ~ 7971776 (-) True XLOC_022155
TCONS_00043745 mRNA downstream 46626 7067196 ~ 7125494 (-) True XLOC_022143
TCONS_00043743 mRNA downstream 119708 6998633 ~ 7052412 (-) False XLOC_022142
TCONS_00043744 mRNA downstream 119758 7000180 ~ 7052362 (-) True XLOC_022142
TCONS_00043738 mRNA downstream 189134 6948941 ~ 6982986 (-) False XLOC_022140
TCONS_00043739 mRNA downstream 189154 6950935 ~ 6982966 (-) False XLOC_022140
TCONS_00043750 mRNA upstream 419806 7592009 ~ 7594723 (-) False XLOC_022150
TCONS_00043752 mRNA upstream 420044 7592247 ~ 7674902 (-) False XLOC_022150
TCONS_00043751 mRNA upstream 420044 7592247 ~ 7674902 (-) True XLOC_022150
TCONS_00043753 mRNA upstream 571278 7743481 ~ 7755373 (-) True XLOC_022152
TCONS_00043755 mRNA upstream 589830 7762033 ~ 7799184 (-) False XLOC_022153
TCONS_00043741 other downstream 189204 6966332 ~ 6982916 (-) True XLOC_022140
TCONS_00043740 other downstream 189246 6961520 ~ 6982874 (-) False XLOC_022140
TCONS_00043708 other downstream 1740603 5431418 ~ 5431517 (-) True XLOC_022121
TCONS_00043707 other downstream 1740801 5431196 ~ 5431319 (-) True XLOC_022120
TCONS_00043706 other downstream 1806775 5300279 ~ 5365345 (-) True XLOC_022119
TCONS_00043748 other upstream 37954 7210157 ~ 7210262 (-) True XLOC_022146
TCONS_00043749 other upstream 408983 7581186 ~ 7581302 (-) True XLOC_022149
TCONS_00043758 other upstream 626890 7799093 ~ 7823785 (-) True XLOC_022153
TCONS_00043759 other upstream 739906 7912109 ~ 7912223 (-) True XLOC_022154
TCONS_00043764 other upstream 2144375 9316578 ~ 9316694 (-) True XLOC_022161