RNA id: TCONS_00000037


Basic Information

Item Value
RNA id TCONS_00000037
length 509
RNA type mRNA
GC content 0.55
exon number 4
gene id XLOC_000017
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 260039 ~ 296057 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACGGTGGACGAGACCGTCAGCACTCTGCAGTTTGCTAGTGCTGCAAAACGGATGAAGAATGACCCTCATGTCACGGAGGTCTCTGATGAAGGAGCTCATATGGATGAGTTTGACAGCCGCTTCGACTTCACTGCTATGGAGGAACCCAACATGGACATGGAGATGAGCAGCATCACTGTCCGCAGCTCCTCGGAGGGGAGTCATTTTCTGGACTCTCCCCGTGCGAGCGAGCTGATGCAGAAGGTGTCGTCTCTGGAGAGTCAGCTGGAGGCCGAGACTCAGAGCAAACAGATAGCAGAAGAGATGAACGCTGAGCTCCAGATGAAGCTCTCGCATCTGCAGAACATGCTGGAGGCTCAGTCTGCACCATCACACGAGGAGAAAAACACCATCTCTGAGCTGGAGAAGCAGATGGAGGATCTGCAGCGGAGACTGGAGACGGAGGTTCAAGAGAGACAAACCGCTGAGGAGAAGAGCATCTCACTGGAGCTGAAGGTGGCAGAGCTGG

Function

GO:

id name namespace
GO:0007018 microtubule-based movement biological_process
GO:0007080 mitotic metaphase plate congression biological_process
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0003777 microtubule motor activity molecular_function
GO:0008017 microtubule binding molecular_function

KEGG:

id description
ko01009 Protein phosphatases and associated proteins
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-060929-860 Predicted to enable microtubule binding activity and plus-end-directed microtubule motor activity. Predicted to be involved in microtubule-based movement and mitotic cell cycle. Predicted to be active in microtubule. Human ortholog(s) of this gene implicated in primary autosomal recessive microcephaly 13. Orthologous to human CENPE (centromere protein E).

Ensembl:

ensembl_id ENSDART00000148172

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00002804 lncRNA upstream 25328 237391 ~ 241707 (+) True XLOC_000015
TCONS_00002803 lncRNA upstream 29612 236400 ~ 237423 (+) False XLOC_000015
TCONS_00002802 lncRNA upstream 31502 227253 ~ 235533 (+) False XLOC_000015
TCONS_00002801 lncRNA upstream 44231 221385 ~ 222804 (+) True XLOC_000014
TCONS_00003002 lncRNA upstream 109753 156792 ~ 157282 (+) True XLOC_000011
TCONS_00003003 lncRNA downstream 85598 355481 ~ 358562 (+) False XLOC_000018
TCONS_00003004 lncRNA downstream 85888 355771 ~ 358562 (+) True XLOC_000018
TCONS_00000055 lncRNA downstream 310805 580688 ~ 586501 (+) True XLOC_000023
TCONS_00003005 lncRNA downstream 525093 794976 ~ 898180 (+) False XLOC_000026
TCONS_00003006 lncRNA downstream 525093 794976 ~ 911551 (+) True XLOC_000026
TCONS_00000033 mRNA upstream 8897 245076 ~ 258138 (+) True XLOC_000016
TCONS_00000032 mRNA upstream 23237 230363 ~ 243798 (+) False XLOC_000015
TCONS_00000031 mRNA upstream 25328 227241 ~ 241707 (+) False XLOC_000015
TCONS_00000030 mRNA upstream 41898 218524 ~ 225137 (+) False XLOC_000014
TCONS_00000029 mRNA upstream 84777 176586 ~ 182258 (+) True XLOC_000013
TCONS_00000038 mRNA downstream 7848 277731 ~ 280259 (+) False XLOC_000017
TCONS_00000039 mRNA downstream 22662 292545 ~ 296057 (+) True XLOC_000017
TCONS_00000040 mRNA downstream 148986 418869 ~ 443759 (+) True XLOC_000019
TCONS_00000041 mRNA downstream 224414 494297 ~ 505620 (+) False XLOC_000020
TCONS_00000042 mRNA downstream 224458 494341 ~ 497021 (+) False XLOC_000020
TCONS_00000003 other upstream 253778 12129 ~ 13257 (+) False XLOC_000001
TCONS_00000047 other downstream 244130 514013 ~ 515322 (+) True XLOC_000021
TCONS_00000052 other downstream 267706 537589 ~ 546217 (+) False XLOC_000023
TCONS_00000053 other downstream 306561 576444 ~ 576521 (+) True XLOC_000024
TCONS_00000060 other downstream 948808 1218691 ~ 1218805 (+) True XLOC_000029
TCONS_00000061 other downstream 1305600 1575483 ~ 1575563 (+) True XLOC_000032

Expression Profile

//