RNA id: TCONS_00048188



Basic Information


Item Value
RNA id TCONS_00048188
length 497
RNA type processed_transcript
GC content 0.57
exon number 4
gene id XLOC_024368
representative True

Chromosome Information


Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 485353 ~ 554142 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATCCTCCTCTTCCAGAAACCGGTACTAATCGCGGTTAGGTTTATTGGCATTTCCAGAACGGTGACGTCGGGTAAGAGTCGTGCTCGTAAATCTGGCCATCACACGCCGTCTCCACCTTTAAGTCCTCGGGCGTCTGAGAGGGAGGAGCCTGTTGATGAGGGGGCGGAGCCTGTGCTGAGCGAGCAGCAGCAGGCAGCAATGCAGCAGGAGGAGAAAGTGTTGACGCAGCAGATAGAAAACCTGCAGAAGGAGAAGGAAGAGCTGACCTATGAGATGCTGGCTTTGGAGCCGCGAGCGTCTGATGATGAGATGCTGGAGTCGGAGGCGTCAATCGGGACGGCGGACAGCTCAGAAAACCTGATGGAGTCGGAGGGAGCCGCTTCTGATCCGTGGGAAAAAAGCCCCGGCGCAGTGTCTGCATCTCGCTGGAGGAAGTCGGAGTCTAAAAGCAGGCGATGTTTGCGGCGTCAGCCTGAATCTCTGGACTCTGTGGATTC

Function


GO:

id name namespace
GO:0043547 positive regulation of GTPase activity biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0007626 locomotory behavior biological_process
GO:0061564 axon development biological_process
GO:0048675 axon extension biological_process
GO:0007165 signal transduction biological_process
GO:0036269 swimming behavior biological_process
GO:0098529 neuromuscular junction development, skeletal muscle fiber biological_process
GO:0042995 cell projection cellular_component
GO:0030426 growth cone cellular_component
GO:0016459 myosin complex cellular_component
GO:0045202 synapse cellular_component
GO:0030054 cell junction cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005096 GTPase activator activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0003774 motor activity molecular_function
GO:0003779 actin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-080424-6 Predicted to enable several functions, including ATP binding activity; GTPase activator activity; and actin binding activity. Acts upstream of or within axon extension; neuromuscular junction development, skeletal muscle fiber; and swimming behavior. Predicted to be located in several cellular components, including cytoplasm; growth cone; and synapse. Predicted to be integral component of membrane. Predicted to be part of myosin complex. Human ortholog(s) of this gene implicated in congenital myasthenic syndrome. Orthologous to human MYO9A (myosin IXA).

Ensembl:

ensembl_id ENSDART00000153559

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00049299 lncRNA downstream 32343 455319 ~ 456478 (-) True XLOC_024366
TCONS_00049070 lncRNA downstream 125053 360538 ~ 363768 (-) True XLOC_024363
TCONS_00049069 lncRNA downstream 183164 305008 ~ 305657 (-) True XLOC_024361
TCONS_00048181 lncRNA downstream 194212 288661 ~ 294609 (-) True XLOC_024360
TCONS_00048180 lncRNA downstream 197474 288661 ~ 291347 (-) False XLOC_024360
TCONS_00049300 lncRNA upstream 140148 630933 ~ 643106 (-) True XLOC_024369
TCONS_00048198 lncRNA upstream 704497 1195282 ~ 1196112 (-) True XLOC_024375
TCONS_00049301 lncRNA upstream 785498 1276283 ~ 1308073 (-) False XLOC_024377
TCONS_00049071 lncRNA upstream 814993 1305778 ~ 1306027 (-) False XLOC_024377
TCONS_00048211 lncRNA upstream 973594 1464379 ~ 1471185 (-) True XLOC_024380
TCONS_00048185 mRNA downstream 5013 479997 ~ 483808 (-) True XLOC_024367
TCONS_00048183 mRNA downstream 112939 371164 ~ 375882 (-) True XLOC_024364
TCONS_00048182 mRNA downstream 140037 314608 ~ 348784 (-) True XLOC_024362
TCONS_00048179 mRNA downstream 219537 265360 ~ 269284 (-) True XLOC_024357
TCONS_00048178 mRNA downstream 232850 254462 ~ 255971 (-) True XLOC_024356
TCONS_00048189 mRNA upstream 219354 710139 ~ 752158 (-) True XLOC_024370
TCONS_00048190 mRNA upstream 277229 768014 ~ 774471 (-) False XLOC_024371
TCONS_00048191 mRNA upstream 277231 768016 ~ 774350 (-) True XLOC_024371
TCONS_00048192 mRNA upstream 330940 821725 ~ 998096 (-) False XLOC_024372
TCONS_00048193 mRNA upstream 376361 867146 ~ 893464 (-) False XLOC_024372
TCONS_00048212 other upstream 1138870 1629655 ~ 1629749 (-) True XLOC_024382
TCONS_00048237 other upstream 2525385 3016170 ~ 3034668 (-) False XLOC_024397
TCONS_00048288 other upstream 3834831 4325616 ~ 4325731 (-) True XLOC_024429
TCONS_00048296 other upstream 4399982 4890767 ~ 4904432 (-) True XLOC_024434
TCONS_00048299 other upstream 4850177 5340962 ~ 5341102 (-) True XLOC_024438

Expression Profile


//