RNA id: TCONS_00058825


Basic Information

Item Value
RNA id TCONS_00058825
length 410
RNA type mRNA
GC content 0.53
exon number 1
gene id XLOC_030081
representative True

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 25072894 ~ 25075179 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGGGGTGCTGTCTGCGCTGGCGCGGGGGTTTGTGAGAGGAGCGGACCGAATGGCGGAGTGGACTAGTAAACGTGGACCCAGGACATTCTACAAGAGCCGTGGAGCAAGACCCACTGGGATAGTCACCTCCAGCAGAAAGTTCATACCTATTCGAGCCATGATCCCAGAGTTTGTGGTACCCAATCTGGAAGGATTTAACCTAAAAGCCTATGTGTCCTACAAAACTCCAGCAGGGACGGAGGAGCCCATGACCCCAGAGAAGCTCTTCAATGAAGTGGTGGCCCCGCAGATCCAGAGGGACATTGAGGAAGGAGTTTTCAGTGAGGACAATCTGGAGAAATACGGACTGGAGAAAACTCAAGAGGGGAAGCTCTTCAAACTGCACCCCAAGAACTTTGCGCGTTAAGT

Function

GO:

id name namespace
GO:0006915 apoptotic process biological_process
GO:0006412 translation biological_process
GO:0007049 cell cycle biological_process
GO:0005762 mitochondrial large ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0005739 mitochondrion cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03011 Ribosome

ZFIN:

id description
ZDB-GENE-050522-200 Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to act upstream of or within apoptotic process. Predicted to be located in mitochondrion and ribosome. Predicted to be part of mitochondrial large ribosomal subunit. Orthologous to human MRPL41 (mitochondrial ribosomal protein L41).

Ensembl:

ensembl_id ENSDART00000188951

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00061700 lncRNA upstream 195083 24873805 ~ 24879565 (+) True XLOC_030079
TCONS_00061699 lncRNA upstream 239331 24816325 ~ 24835317 (+) True XLOC_030078
TCONS_00058822 lncRNA upstream 513473 24557130 ~ 24561175 (+) True XLOC_030077
TCONS_00058821 lncRNA upstream 517823 24552423 ~ 24556825 (+) False XLOC_030077
TCONS_00061433 lncRNA upstream 602572 24469471 ~ 24472076 (+) True XLOC_030075
TCONS_00061434 lncRNA downstream 173141 25248198 ~ 25249676 (+) True XLOC_030083
TCONS_00061701 lncRNA downstream 236206 25311263 ~ 25314751 (+) False XLOC_030085
TCONS_00061702 lncRNA downstream 625968 25701025 ~ 25710432 (+) True XLOC_030090
TCONS_00058864 lncRNA downstream 1154161 26229218 ~ 26233068 (+) True XLOC_030104
TCONS_00061435 lncRNA downstream 1404617 26479674 ~ 26481301 (+) True XLOC_030106
TCONS_00058823 mRNA upstream 188051 24882633 ~ 24886597 (+) True XLOC_030080
TCONS_00058820 mRNA upstream 506779 24543862 ~ 24567869 (+) False XLOC_030077
TCONS_00058818 mRNA upstream 542262 24520437 ~ 24532386 (+) False XLOC_030076
TCONS_00058817 mRNA upstream 764981 24305877 ~ 24309667 (+) True XLOC_030073
TCONS_00058816 mRNA upstream 780488 24287927 ~ 24294160 (+) True XLOC_030072
TCONS_00058826 mRNA downstream 9328 25084385 ~ 25087292 (+) False XLOC_030082
TCONS_00058827 mRNA downstream 9353 25084410 ~ 25087189 (+) True XLOC_030082
TCONS_00058828 mRNA downstream 229442 25304499 ~ 25309549 (+) True XLOC_030084
TCONS_00058829 mRNA downstream 236252 25311309 ~ 25314752 (+) True XLOC_030085
TCONS_00058830 mRNA downstream 242004 25317061 ~ 25358683 (+) True XLOC_030086
TCONS_00058819 other upstream 552898 24521682 ~ 24521750 (+) True XLOC_030076
TCONS_00058808 other upstream 939079 24132301 ~ 24135569 (+) False XLOC_030066
TCONS_00058805 other upstream 980781 24089324 ~ 24093867 (+) False XLOC_030065
TCONS_00058803 other upstream 983301 24086598 ~ 24091347 (+) False XLOC_030065
TCONS_00058790 other upstream 1164199 23910333 ~ 23910449 (+) True XLOC_030058
TCONS_00058834 other downstream 605785 25680842 ~ 25682105 (+) False XLOC_030089
TCONS_00058845 other downstream 736816 25811873 ~ 25812239 (+) True XLOC_030092
TCONS_00058848 other downstream 897011 25972068 ~ 25972160 (+) True XLOC_030094
TCONS_00058859 other downstream 1137575 26212632 ~ 26220157 (+) False XLOC_030103
TCONS_00058863 other downstream 1145959 26221016 ~ 26233068 (+) False XLOC_030104

Expression Profile

//