RNA id: TCONS_00059859


Basic Information

Item Value
RNA id TCONS_00059859
length 513
RNA type mRNA
GC content 0.54
exon number 8
gene id XLOC_030736
representative False

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 1432074 ~ 1487262 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTGGTGTCGTTCGCTCAGCTGCGCGAGAGGATGGCGGACCAGAACAGGCAAATCAAACTCGCTGCAGCTAAGAAAAAGCTGAAGGAGTTTCAGCAGAAGACGATTCCATCCACGGGAAGTGCCGGACCAAAGAAGAAGAGGAAGGTTAAAGGAGATCAGACAGACGCTCCTGCTGACCGCCGCTCTCCAGAAAATAATTATCCAGCAGATGCCAACGGCGATGAACACCCCCTGGAAAACAACAGGCCGCTGTCGTCCACCGAAAGCCTCCGACAGCTCTCTCAGCAGCTCAACGGTCTGCTCTCTGAGTCATCAACACACATCAATGGTGACAGCGATCCACCCGCGGTCAATGAGAAGGAGCTGGAGACTCGTAATCAGGAGTTATCCGCTGCTCTGGACTCCAGCGCTCTCACCAACACACAGCTCACGTCCAAACTGGAGACTCTGACGAAGCAGTCTCAGGAGCTCTCAGATCAGCTGCAGAAGGAAAGGAAAGAGTTTGAGCAGAAG

Function

GO:

id name namespace
GO:0007519 skeletal muscle tissue development biological_process
GO:0007030 Golgi organization biological_process
GO:0007420 brain development biological_process
GO:0001966 thigmotaxis biological_process
GO:0032580 Golgi cisterna membrane cellular_component
GO:0005794 Golgi apparatus cellular_component
GO:0005801 cis-Golgi network cellular_component
GO:0000137 Golgi cis cisterna cellular_component

KEGG:

id description
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-081030-1 Acts upstream of or within brain development; skeletal muscle tissue development; and thigmotaxis. Predicted to be located in Golgi apparatus. Predicted to be active in Golgi cis cisterna; Golgi cisterna membrane; and cis-Golgi network. Is expressed in otic vesicle. Orthologous to several human genes including GOLGA2 (golgin A2).

Ensembl:

ensembl_id ENSDART00000149599

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00059857 lncRNA downstream 7461 1454386 ~ 1456830 (-) False XLOC_030736
TCONS_00061909 lncRNA downstream 44760 1317890 ~ 1419531 (-) False XLOC_030734
TCONS_00061910 lncRNA downstream 44760 1418148 ~ 1419531 (-) True XLOC_030734
TCONS_00061908 lncRNA downstream 379542 1006450 ~ 1084749 (-) True XLOC_030728
TCONS_00061505 lncRNA downstream 538214 921488 ~ 926077 (-) True XLOC_030725
TCONS_00061911 lncRNA upstream 392255 1879511 ~ 1906537 (-) True XLOC_030740
TCONS_00061912 lncRNA upstream 502204 1989460 ~ 1991666 (-) True XLOC_030745
TCONS_00061913 lncRNA upstream 510508 1997764 ~ 1998553 (-) False XLOC_030746
TCONS_00059871 lncRNA upstream 510508 1997764 ~ 1999493 (-) False XLOC_030746
TCONS_00059881 lncRNA upstream 1285033 2772289 ~ 2775472 (-) True XLOC_030755
TCONS_00059853 mRNA downstream 189480 1247718 ~ 1274811 (-) False XLOC_030733
TCONS_00059852 mRNA downstream 189497 1239657 ~ 1274794 (-) False XLOC_030733
TCONS_00059854 mRNA downstream 199941 1250980 ~ 1264350 (-) True XLOC_030733
TCONS_00059851 mRNA downstream 245490 1203767 ~ 1218801 (-) True XLOC_030732
TCONS_00059849 mRNA downstream 260836 1180703 ~ 1203455 (-) True XLOC_030730
TCONS_00059862 mRNA upstream 181222 1668478 ~ 1827575 (-) True XLOC_030737
TCONS_00059863 mRNA upstream 346485 1833741 ~ 1869982 (-) True XLOC_030738
TCONS_00059865 mRNA upstream 463404 1950660 ~ 1963498 (-) False XLOC_030741
TCONS_00059867 mRNA upstream 468399 1955655 ~ 1962500 (-) True XLOC_030741
TCONS_00059870 mRNA upstream 510509 1997765 ~ 1999417 (-) True XLOC_030746
TCONS_00059855 other downstream 87423 1376773 ~ 1376868 (-) True XLOC_030735
TCONS_00059850 other downstream 282767 1181409 ~ 1181524 (-) True XLOC_030731
TCONS_00059845 other downstream 466363 997812 ~ 997928 (-) True XLOC_030726
TCONS_00059844 other downstream 628001 836137 ~ 836290 (-) True XLOC_030724
TCONS_00059843 other downstream 630358 833599 ~ 833933 (-) True XLOC_030723
TCONS_00059864 other upstream 349893 1837149 ~ 1837260 (-) True XLOC_030739
TCONS_00059866 other upstream 465396 1952652 ~ 1952778 (-) True XLOC_030742
TCONS_00059868 other upstream 472817 1960073 ~ 1960200 (-) True XLOC_030743
TCONS_00059869 other upstream 475026 1962282 ~ 1962409 (-) True XLOC_030744
TCONS_00059873 other upstream 725416 2212672 ~ 2212788 (-) True XLOC_030748

Expression Profile

//