RNA id: TCONS_00074530


Basic Information

Item Value
RNA id TCONS_00074530
length 364
RNA type processed_transcript
GC content 0.44
exon number 3
gene id XLOC_037978
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 33366683 ~ 33608427 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CATGGATGGAGCAGATCTCTGCTTTGAGATTGTGAAGAGAGCAGACGCTGGCTTTGTTTACAGTGAAGCGGTAGCCAGTCACTACATGAGACAGATCCTAGAGGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAGTGAGAACTAGCAAATTACACATTACCATCATCACACTAAGAATAAACTGCTTCAAAAACAGCTGCTCTTTTCTCATAAGTAGCCTGCAGCCGCCAGTGTTTAGTGGTCAGTTGCTAAGTGATGAGCGCATAACCAGTTGATGTAATTTTAATCAAAGCTCCCACCAATAAACCACAATTAGGCCAGTTTCAGTGTGGATTGAGTCTGTATTTT

Function

GO:

id name namespace
GO:0006468 protein phosphorylation biological_process
GO:0005524 ATP binding molecular_function
GO:0004672 protein kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-020802-4 Predicted to enable ATP binding activity and protein kinase activity. Predicted to act upstream of or within protein phosphorylation. Is expressed in nervous system; notochord; optic vesicle; and yolk syncytial layer. Human ortholog(s) of this gene implicated in FG syndrome and syndromic X-linked intellectual disability Najm type. Orthologous to human CASK (calcium/calmodulin dependent serine protein kinase).

Ensembl:

ensembl_id ENSDART00000135366

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00074529 lncRNA downstream 44009 33381720 ~ 33394953 (-) False XLOC_037978
TCONS_00075398 lncRNA downstream 79918 33356651 ~ 33359044 (-) True XLOC_037977
TCONS_00075397 lncRNA downstream 236058 33201515 ~ 33202904 (-) False XLOC_037974
TCONS_00075396 lncRNA downstream 259946 33177648 ~ 33179016 (-) True XLOC_037973
TCONS_00075395 lncRNA downstream 317289 33119224 ~ 33121673 (-) True XLOC_037971
TCONS_00074535 lncRNA upstream 319155 33758720 ~ 33781851 (-) True XLOC_037981
TCONS_00075399 lncRNA upstream 343990 33783555 ~ 33785153 (-) False XLOC_037982
TCONS_00074539 lncRNA upstream 344523 33784088 ~ 33785153 (-) True XLOC_037982
TCONS_00075400 lncRNA upstream 481989 33921554 ~ 33938391 (-) False XLOC_037985
TCONS_00075401 lncRNA upstream 481989 33921554 ~ 33955861 (-) False XLOC_037985
TCONS_00074522 mRNA downstream 109175 33323104 ~ 33329787 (-) False XLOC_037976
TCONS_00074525 mRNA downstream 109262 33325212 ~ 33329700 (-) True XLOC_037976
TCONS_00074523 mRNA downstream 110014 33323110 ~ 33328948 (-) False XLOC_037976
TCONS_00074517 mRNA downstream 236723 33201906 ~ 33202239 (-) True XLOC_037974
TCONS_00074516 mRNA downstream 301972 33134882 ~ 33136990 (-) True XLOC_037972
TCONS_00074531 mRNA upstream 221399 33660964 ~ 33725972 (-) True XLOC_037979
TCONS_00074532 mRNA upstream 295285 33734850 ~ 33749556 (-) False XLOC_037980
TCONS_00074533 mRNA upstream 295403 33734968 ~ 33741629 (-) True XLOC_037980
TCONS_00074534 mRNA upstream 319155 33758720 ~ 33781845 (-) False XLOC_037981
TCONS_00074536 mRNA upstream 343984 33783549 ~ 33785200 (-) False XLOC_037982
TCONS_00074528 other downstream 56496 33381249 ~ 33382466 (-) False XLOC_037978
TCONS_00074524 other downstream 110018 33324872 ~ 33328944 (-) False XLOC_037976
TCONS_00074520 other downstream 187956 33247366 ~ 33251006 (-) False XLOC_037975
TCONS_00074521 other downstream 187968 33249278 ~ 33250994 (-) True XLOC_037975
TCONS_00074519 other downstream 188883 33247363 ~ 33250079 (-) False XLOC_037975
TCONS_00074537 other upstream 343990 33783555 ~ 33784507 (-) False XLOC_037982
TCONS_00074543 other upstream 481367 33920932 ~ 33921024 (-) True XLOC_037984
TCONS_00074544 other upstream 481899 33921464 ~ 33921571 (-) False XLOC_037985
TCONS_00074564 other upstream 1313479 34753044 ~ 34753159 (-) True XLOC_038002
TCONS_00074567 other upstream 1409295 34848860 ~ 34851804 (-) True XLOC_038004