RNA id: AMCG00014298


Basic Information

Item Value
RNA id AMCG00014298
length 243
RNA type mRNA
GC content 0.56
exon number 3
gene id AMCG00014298
representative False

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 8155932 ~ 8158590 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGTGCATTGACTCTGAGGGCAAGCTGTGGGTGGCCTGCTACAGCGGAGGACGAGTCCTGCGGATAGACCCGGTGACAGGTGAAAGAATCCAGACGGTGAAGCTGCCTGTGGAAAAGACCACATCGTGCAGCTTCGGTGGGAAGGACTATTCGGAGCTTTACGTGACCACAGCCTGCGAGGGGATGGACCAGGACTTGGTGGTTAAGCAGCCGGAAGCTGGAGGCATTTTTAAGTGGTTGTAG

Function

GO:

id name namespace
GO:0019853 L-ascorbic acid biosynthetic process biological_process
GO:0032781 positive regulation of ATPase activity biological_process
GO:0050848 regulation of calcium-mediated signaling biological_process
GO:0006874 cellular calcium ion homeostasis biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0030234 enzyme regulator activity molecular_function
GO:0008270 zinc ion binding molecular_function
GO:0004341 gluconolactonase activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU86291 lncRNA downstream 19738 8134903 ~ 8136194 (-) True AMCG00014297
TU86202 lncRNA downstream 281574 7874153 ~ 7874358 (-) True G68981
TU86117 lncRNA downstream 529557 7625985 ~ 7626375 (-) True G68905
TU86087 lncRNA downstream 690270 7465409 ~ 7465662 (-) True G68875
TU86086 lncRNA downstream 696043 7455978 ~ 7459889 (-) True G68874
TU86331 lncRNA upstream 68006 8226494 ~ 8250561 (-) True G69086
TU86493 lncRNA upstream 732068 8890556 ~ 8890839 (-) True G69233
TU86513 lncRNA upstream 839938 8998426 ~ 8998626 (-) True G69250
TU86641 lncRNA upstream 1191300 9349788 ~ 9355238 (-) True G69352
TU86667 lncRNA upstream 1431336 9589824 ~ 9590081 (-) True G69372
AMCG00014295 mRNA downstream 529 8148387 ~ 8155403 (-) True AMCG00014295
AMCG00014296 mRNA downstream 8924 8142189 ~ 8147008 (-) True AMCG00014296
AMCG00014297 mRNA downstream 17144 8135222 ~ 8138788 (-) False AMCG00014297
AMCG00014291 mRNA downstream 95914 8020985 ~ 8060018 (-) True AMCG00014291
AMCG00014286 mRNA downstream 372930 7752906 ~ 7783002 (-) True AMCG00014286
AMCG00014300 mRNA upstream 7754 8166242 ~ 8186240 (-) True AMCG00014300
AMCG00014301 mRNA upstream 30535 8189023 ~ 8197625 (-) True AMCG00014301
AMCG00014302 mRNA upstream 101239 8259727 ~ 8260980 (-) True AMCG00014302
AMCG00014303 mRNA upstream 146043 8304531 ~ 8305181 (-) True AMCG00014303
AMCG00014305 mRNA upstream 163946 8322434 ~ 8326420 (-) True AMCG00014305
TU86293 other downstream 16806 8137331 ~ 8139126 (-) False AMCG00014297
TU86071 other downstream 732641 7417598 ~ 7423291 (-) False AMCG00014278
TU86038 other downstream 775152 7378088 ~ 7380780 (-) True AMCG00014271
TU85055 other downstream 5326788 2825562 ~ 2829144 (-) True G68088
TU84998 other downstream 5512025 2641059 ~ 2643907 (-) False AMCG00014144
TU86412 other upstream 224797 8383285 ~ 8384224 (-) True G69156
TU86630 other upstream 1151963 9310451 ~ 9317167 (-) True AMCG00014328
TU86854 other upstream 2638228 10796716 ~ 10798147 (-) True G69537
TU87063 other upstream 3501533 11660021 ~ 11662493 (-) False AMCG00014374
TU90285 other upstream 20171251 28329739 ~ 28332482 (-) True G72236

Expression Profile