RNA id: AMCG00020651


Basic Information

Item Value
RNA id AMCG00020651
length 294
RNA type mRNA
GC content 0.53
exon number 3
gene id AMCG00020651
representative True

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 27752194 ~ 27786025 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGACGGCACAACGGGGCTCCTGTGTTGCCGACAATGTGGACGTTCTGCTGGACCAGAAACAAGTGACCAACAACTGTGTAGGAACTACAGTGATGCGAATGACTGCCTACGACGCTGACGACCCCAACACTGATAACGCCGTGCTGAGATACAACATCGTCAAACAGACGCCAGACCAACCCTCGCCAAACATGTTCTACATTGACCCTGAAAAGGGGGACATCGTCACGGTGGTGTCCCCTGCGCTGCTGGACAGAGAGCTTTGCACAGAGAAGCTGTTTAAGTCTTGTTGA

Function

GO:

id name namespace
GO:0006091 generation of precursor metabolites and energy biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU80977 lncRNA downstream 331548 27420366 ~ 27420646 (-) True G64745
TU80932 lncRNA downstream 515872 27236083 ~ 27236322 (-) True G64708
TU80850 lncRNA downstream 1006371 26745549 ~ 26745823 (-) True G64632
TU80848 lncRNA downstream 1019906 26731435 ~ 26732288 (-) True G64630
TU80847 lncRNA downstream 1022083 26729855 ~ 26730111 (-) True G64629
TU81054 lncRNA upstream 375577 28161602 ~ 28187431 (-) False AMCG00020657
TU81047 lncRNA upstream 399584 28185609 ~ 28187431 (-) False AMCG00020657
TU81049 lncRNA upstream 399584 28185609 ~ 28239074 (-) False AMCG00020657
TU81115 lncRNA upstream 530744 28316769 ~ 28323164 (-) True G64847
TU81159 lncRNA upstream 1071964 28857989 ~ 28858354 (-) True G64886
AMCG00020650 mRNA downstream 40490 27599214 ~ 27711704 (-) True AMCG00020650
AMCG00020649 mRNA downstream 228646 27522624 ~ 27523548 (-) True AMCG00020649
AMCG00020646 mRNA downstream 277462 27435669 ~ 27474732 (-) True AMCG00020646
AMCG00020645 mRNA downstream 326717 27421048 ~ 27425477 (-) True AMCG00020645
AMCG00020643 mRNA downstream 344082 27406955 ~ 27408112 (-) True AMCG00020643
AMCG00020652 mRNA upstream 9231 27795256 ~ 27857618 (-) True AMCG00020652
AMCG00020653 mRNA upstream 77450 27863475 ~ 28035409 (-) True AMCG00020653
AMCG00020658 mRNA upstream 351205 28137230 ~ 28147847 (-) True AMCG00020658
AMCG00020657 mRNA upstream 392696 28178721 ~ 28191734 (-) True AMCG00020657
AMCG00020659 mRNA upstream 464848 28250873 ~ 28265191 (-) True AMCG00020659
TU80934 other downstream 502518 27246014 ~ 27249676 (-) True AMCG00020639
TU80656 other downstream 1833564 25898428 ~ 25918630 (-) False G64470
TU80657 other downstream 1846583 25898428 ~ 25905611 (-) True G64470
TU80433 other downstream 2421624 25330084 ~ 25330570 (-) True G64298
TU80419 other downstream 2449213 25298802 ~ 25302981 (-) False AMCG00020590
TU81066 other upstream 440510 28226535 ~ 28229647 (-) True G64811
TU81116 other upstream 539282 28325307 ~ 28328312 (-) False AMCG00020661
TU81155 other upstream 1002555 28788580 ~ 28796956 (-) True G64882
TU81300 other upstream 1595290 29381315 ~ 29405636 (-) True G65000
TU81316 other upstream 1743894 29529919 ~ 29533117 (-) False AMCG00020685

Expression Profile