RNA id: TU1280


Basic Information

Item Value
RNA id TU1280
length 232
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G880
representative True

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 4500557 ~ 4500788 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

TGGGAGGCAAGCCGGAAAACGACGCACTCGAGCGATCGGGACGGTTTTGTTTTTCCACCTTTTGCAGCGTAAACGGGGAAGGGGGCTCATCCCTACCGAGGGGTGAAAGCTGGCTGGCTGTCACTCAAACCCTCGGCAAAATAACAAACATGCGCCAACACGCTGAACCAACAGTGTGAATGCCAGTAGTGCATATCATGTCACAGGAAAAAAACGGGTCTTTTACTTTGTG

Function

GO:

id name namespace
GO:0051147 regulation of muscle cell differentiation biological_process
GO:0051149 positive regulation of muscle cell differentiation biological_process
GO:0051153 regulation of striated muscle cell differentiation biological_process
GO:0051155 positive regulation of striated muscle cell differentiation biological_process
GO:0045597 positive regulation of cell differentiation biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
XR_006251102.1 lncRNA downstream 46377 4446059 ~ 4454180 (-) True LOC122346152
TU1173 lncRNA downstream 462587 4037738 ~ 4037970 (-) True G803
TU1167 lncRNA downstream 472449 4026105 ~ 4028108 (-) True G797
TU1164 lncRNA downstream 474510 4024706 ~ 4026047 (-) True G794
TU1162 lncRNA downstream 476315 4022367 ~ 4024242 (-) True G792
TU1283 lncRNA upstream 5490 4506278 ~ 4506559 (-) True G883
TU1285 lncRNA upstream 10006 4510794 ~ 4511385 (-) True G885
TU1289 lncRNA upstream 50781 4551569 ~ 4553272 (-) True G888
TU1292 lncRNA upstream 55581 4556369 ~ 4557498 (-) True G889
XR_006251101.1 lncRNA upstream 118458 4619246 ~ 4623921 (-) True LOC122346147
XM_043251462.1 mRNA downstream 799312 3695165 ~ 3701245 (-) False LOC122353624
XM_043251470.1 mRNA downstream 799312 3695165 ~ 3701245 (-) True LOC122353624
XM_043251495.1 mRNA downstream 1215771 3202552 ~ 3284786 (-) False gpc5a
XM_043251484.1 mRNA downstream 1215777 3136508 ~ 3284780 (-) True gpc5a
XM_043235137.1 mRNA downstream 1760968 2732846 ~ 2739589 (-) True cep97
XM_043240772.1 mRNA upstream 31001 4531789 ~ 4546466 (-) True ndfip2
XM_043240711.1 mRNA upstream 69046 4569834 ~ 4574420 (-) False mnx2b
XM_043240702.1 mRNA upstream 69046 4569834 ~ 4574420 (-) True mnx2b
XM_043240393.1 mRNA upstream 96292 4597080 ~ 4618627 (-) True fn1b
XM_043240404.1 mRNA upstream 96292 4597080 ~ 4618626 (-) False fn1b
TU1193 other downstream 201364 4298310 ~ 4299193 (-) True G820
TU1152 other downstream 486270 4007840 ~ 4014287 (-) True G782
TU999 other downstream 1811093 2688765 ~ 2689464 (-) True G654
XR_006250784.1 other downstream 2895573 1594758 ~ 1604984 (-) False LOC122343438
XR_006252053.1 other downstream 3370920 1129499 ~ 1129637 (-) True LOC122353706
XR_006252050.1 other upstream 1276783 5777571 ~ 5777657 (-) True LOC122353693
XR_006251180.1 other upstream 1345288 5846076 ~ 5853244 (-) False LOC122346875
TU1845 other upstream 1610675 6111463 ~ 6113523 (-) True G1270
XR_006251170.1 other upstream 1766875 6267663 ~ 6274751 (-) False si:ch211-14k19.8
XR_006251174.1 other upstream 1957263 6458051 ~ 6468254 (-) False gaa2

Expression Profile