G240881


Basic Information

Item Value
gene id G240881
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 3453287 ~ 3453502 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU273361
GCTTGCTGTTGGTGTTAGCATATTGCTAAGCTTAACCATGAGGAAAAAGTGAAGCACCTTATTAGAATCGACGGGATGCCCTAATAAACATACACATACAAACAAACAAATACGTTCCACACGCAAATATTGGTTTAAATAATCACCTTTTTTAAAATTGATTGTTTTTATGGTTTGGTTTTATTATTAAATTAATTATTTTTAGGTACTCGGCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU273361 True 216 lncRNA 0.32 1 3453287 3453502

Neighbor

gene id symbol gene type direction distance location
CI01000055_03367394_03368952 NA coding downstream 84296 3366054 ~ 3368991 (-)
CI01000055_03348848_03351995 TRUB1 coding downstream 101282 3348584 ~ 3352005 (-)
CI01000055_03242747_03342954 ATRNL1, ATRNL1B coding downstream 109913 3241225 ~ 3343374 (-)
CI01000055_02936803_03111716 NRG3, NRG3B coding downstream 341571 2936803 ~ 3111716 (-)
CI01000055_02905189_02913362 SH2D4BB coding downstream 539737 2905000 ~ 2913550 (-)
CI01000055_03480523_03482073 NA coding upstream 26709 3480211 ~ 3482221 (-)
CI01000055_03498800_03512565 VWA2 coding upstream 44381 3497883 ~ 3512565 (-)
CI01000055_03518013_03528878 NA coding upstream 64052 3517554 ~ 3528878 (-)
CI01000055_03574677_03575939 ADRB1 coding upstream 119834 3573336 ~ 3575939 (-)
CI01000055_03585354_03604468 NHLRC2 coding upstream 130578 3584080 ~ 3604468 (-)
G240878 NA non-coding downstream 2433 3450642 ~ 3450854 (-)
G240877 NA non-coding downstream 2753 3450285 ~ 3450534 (-)
G240876 NA non-coding downstream 3272 3449726 ~ 3450015 (-)
G240851 NA non-coding downstream 96844 3353639 ~ 3356443 (-)
G240885 NA non-coding upstream 40698 3494200 ~ 3494864 (-)
G240884 NA non-coding upstream 110311 3563813 ~ 3565842 (-)
G240949 NA non-coding upstream 206014 3659516 ~ 3665515 (-)
G240950 NA non-coding upstream 212804 3666306 ~ 3666603 (-)
G240954 NA non-coding upstream 223733 3677235 ~ 3680938 (-)
G240825 NA other downstream 235693 3216174 ~ 3217594 (-)
G240723 NA other downstream 703935 2748835 ~ 2749352 (-)
G238932 NA other downstream 1134233 2311659 ~ 2319054 (-)
G238867 NA other downstream 2158764 1281108 ~ 1294523 (-)
G238481 NA other downstream 2188479 1263634 ~ 1264808 (-)
CI01000055_03616564_03618430 NA other upstream 162844 3616555 ~ 3618430 (-)
G240975 NA other upstream 264149 3717651 ~ 3733995 (-)
CI01000055_03918168_03965674 TCF7L2 other upstream 457800 3911302 ~ 3966460 (-)
CI01000055_04744063_04763284 FAM19A5, FAM19A5B other upstream 1290204 4743706 ~ 4764067 (-)
CI01000055_05338403_05341971 NA other upstream 1880783 5338403 ~ 5341971 (-)

Expression


Co-expression Network