G240959


Basic Information

Item Value
gene id G240959
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 3686062 ~ 3686286 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU273459
TGCTTTTGGCATTATGGGTCAACACTTGCATTGGAAAAGCAAGAAAATAAACATGATTTATTTCCTTAAACTGATTTTCATTATGTCCCAGCAATAGTCAGCGAGGCCCCGCTGAGCAGTTCCTCCAATCTGCCGGGATGATAACTGCTATTTTACAGCTTGTATAGTGATTAGTGATCCATCCATCCATCCATCCATCCATCCATCCATCTATCTATCTATCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU273459 True 225 lncRNA 0.40 1 3686062 3686286

Neighbor

gene id symbol gene type direction distance location
CI01000055_03658872_03663877 CASP7 coding downstream 22023 3658303 ~ 3664039 (-)
CI01000055_03643253_03646423 NA coding downstream 39639 3643174 ~ 3646423 (-)
CI01000055_03626294_03640787 NA coding downstream 45275 3626190 ~ 3640787 (-)
CI01000055_03616564_03618430 NA coding downstream 67632 3616555 ~ 3618430 (-)
CI01000055_03585354_03604468 NHLRC2 coding downstream 81594 3584080 ~ 3604468 (-)
CI01000055_03766205_03773588 ENTPD1 coding upstream 79008 3765294 ~ 3773588 (-)
CI01000055_03783468_03784414 NA coding upstream 96399 3782685 ~ 3784513 (-)
CI01000055_03808541_03810277 CRYGMX coding upstream 122007 3808293 ~ 3810490 (-)
CI01000055_03810913_03811894 CRYGMXL2 coding upstream 124445 3810550 ~ 3811894 (-)
CI01000055_03880394_03898922 TCF7L2 coding upstream 193983 3880269 ~ 3898935 (-)
G240954 NA non-coding downstream 5124 3677235 ~ 3680938 (-)
G240950 NA non-coding downstream 19459 3666306 ~ 3666603 (-)
G240949 NA non-coding downstream 20547 3659516 ~ 3665515 (-)
G240884 NA non-coding downstream 120220 3563813 ~ 3565842 (-)
G240885 NA non-coding downstream 191198 3494200 ~ 3494864 (-)
G240963 NA non-coding upstream 6305 3692591 ~ 3692839 (-)
G240969 NA non-coding upstream 20882 3707168 ~ 3707380 (-)
G241028 NA non-coding upstream 146209 3832495 ~ 3833001 (-)
G241037 NA non-coding upstream 163852 3850138 ~ 3850372 (-)
G240825 NA other downstream 468468 3216174 ~ 3217594 (-)
G240723 NA other downstream 936710 2748835 ~ 2749352 (-)
G238932 NA other downstream 1367008 2311659 ~ 2319054 (-)
G238867 NA other downstream 2391539 1281108 ~ 1294523 (-)
G240975 NA other upstream 31365 3717651 ~ 3733995 (-)
CI01000055_03918168_03965674 TCF7L2 other upstream 225016 3911302 ~ 3966460 (-)
CI01000055_04744063_04763284 FAM19A5, FAM19A5B other upstream 1057420 4743706 ~ 4764067 (-)
CI01000055_05338403_05341971 NA other upstream 1647999 5338403 ~ 5341971 (-)
G241542 NA other upstream 1875057 5561343 ~ 5565783 (-)

Expression


Co-expression Network