G241028


Basic Information

Item Value
gene id G241028
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 3832495 ~ 3833001 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU273536
GTTTTTCTCTAGTTCACATTGGCCACAATTATTGGCACCCAATTATTGCAATGTCCTTTTGCCAAGATAACAGCTCTAAGTCTTCTAAAATGCCTGATGAGTTTGGAGAACACCTGACAAGAGATCAGAGACCATTCCTTCATTCAGAATCCCTCGAGATCCTTCAGATTCCCAGCTCCACGTTGGTGCTTCTTCTCTTCAGTTCACTCCACTCATTTTCTTTAGGGTTCAGGTCAGGGGACTGGGATGGTCATGGCAGAAGCTTCATTTTGTGCTCAGTGACACATTTTTGTGTTGGTTTTGATGTTTGTTTTGGATCATTGTCCCGATGGAAGATCCAATCACGGCCCATTATAAGATTTCTAGCAGAAGTGGTCAGGTTTTGATTTTTATCTGTTAGTATTTGATAGAATCCATGATGCCATGTATCTGAACAAGATGTCCAGGACCTCCAGCAGAAAAATAGGCCAACAACATTAAAGATCCAGCAGTATATTTAACCGTGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU273536 True 507 lncRNA 0.42 1 3832495 3833001

Neighbor

gene id symbol gene type direction distance location
CI01000055_03810913_03811894 CRYGMXL2 coding downstream 20601 3810550 ~ 3811894 (-)
CI01000055_03808541_03810277 CRYGMX coding downstream 22005 3808293 ~ 3810490 (-)
CI01000055_03783468_03784414 NA coding downstream 47982 3782685 ~ 3784513 (-)
CI01000055_03766205_03773588 ENTPD1 coding downstream 58907 3765294 ~ 3773588 (-)
CI01000055_03658872_03663877 CASP7 coding downstream 168456 3658303 ~ 3664039 (-)
CI01000055_03880394_03898922 TCF7L2 coding upstream 47268 3880269 ~ 3898935 (-)
CI01000055_03918168_03965674 TCF7L2 coding upstream 84101 3911302 ~ 3966460 (-)
CI01000055_04132203_04169742 CA16C, PTPRZ1 coding upstream 299084 4132085 ~ 4169742 (-)
CI01000055_04232088_04245445 AGBL2 coding upstream 398941 4231942 ~ 4245445 (-)
CI01000055_04247379_04257962 FNBP4 coding upstream 414378 4247379 ~ 4257962 (-)
G240969 NA non-coding downstream 125115 3707168 ~ 3707380 (-)
G240963 NA non-coding downstream 139656 3692591 ~ 3692839 (-)
G240959 NA non-coding downstream 146209 3686062 ~ 3686286 (-)
G240954 NA non-coding downstream 151557 3677235 ~ 3680938 (-)
G241037 NA non-coding upstream 17137 3850138 ~ 3850372 (-)
G241048 NA non-coding upstream 39742 3872743 ~ 3873057 (-)
G241051 NA non-coding upstream 155667 3988668 ~ 3989097 (-)
G241055 NA non-coding upstream 190185 4023186 ~ 4029661 (-)
G241061 NA non-coding upstream 196689 4029690 ~ 4036639 (-)
G240975 NA other downstream 98500 3717651 ~ 3733995 (-)
CI01000055_03616564_03618430 NA other downstream 212851 3616555 ~ 3618430 (-)
G240825 NA other downstream 614901 3216174 ~ 3217594 (-)
G240723 NA other downstream 1083143 2748835 ~ 2749352 (-)
G238932 NA other downstream 1513441 2311659 ~ 2319054 (-)
CI01000055_04744063_04763284 FAM19A5, FAM19A5B other upstream 910705 4743706 ~ 4764067 (-)
CI01000055_05338403_05341971 NA other upstream 1501284 5338403 ~ 5341971 (-)
G241542 NA other upstream 1728342 5561343 ~ 5565783 (-)
G241646 NA other upstream 2009193 5842194 ~ 5847572 (-)

Expression


Co-expression Network