G241145


Basic Information

Item Value
gene id G241145
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 4071426 ~ 4076408 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU273660
CCTTTTGACACAGGCCTCCATCATATCACTAGCCATCAGTTTGAGCCTCTGCTCCAGATGTTTGGCGAACTCCGGCTCTGGCCAGTGCAGGTCCATCACGAACATCTGAAGAGCATCCAGCTTCCAGAATAGATCTTCTGATGTGGCTGAGCCGTTATTCACAGATTGCCACGTCTCCTGTTCAAAGCCGCGGTGAATGGACTGAGCTATAGATGACTCCATCAGGTCAATGTAGCGCACCACCAGAGGGATGTACAGGTCCTGGAGGTGCTTATGGAACGTTCCATTGTACAGGTGAGCTGGAGAACATGAAGGAAGAATGAAGGCTTAACAATGTATCGGATGATGTGCAACCAATATTACAGGGCAAAATATTGTTACACCCCTTAATGCTGTACTGCAGTGGAAATATATCTAGAACACCACTTCGAGAAATCATTGGCAACATTTCATTGACAAAAATCATTTAAATAATATAACATATATACGATTTCAAAACACTGCTTCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU273660 True 509 lncRNA 0.44 2 4071426 4076408

Neighbor

gene id symbol gene type direction distance location
CI01000055_03918168_03965674 TCF7L2 coding downstream 104966 3911302 ~ 3966460 (-)
CI01000055_03880394_03898922 TCF7L2 coding downstream 172491 3880269 ~ 3898935 (-)
CI01000055_03810913_03811894 CRYGMXL2 coding downstream 259532 3810550 ~ 3811894 (-)
CI01000055_03808541_03810277 CRYGMX coding downstream 260936 3808293 ~ 3810490 (-)
CI01000055_03783468_03784414 NA coding downstream 286913 3782685 ~ 3784513 (-)
CI01000055_04132203_04169742 CA16C, PTPRZ1 coding upstream 55677 4132085 ~ 4169742 (-)
CI01000055_04232088_04245445 AGBL2 coding upstream 155534 4231942 ~ 4245445 (-)
CI01000055_04247379_04257962 FNBP4 coding upstream 170971 4247379 ~ 4257962 (-)
CI01000055_04259719_04260531 LRRC10 coding upstream 182971 4259379 ~ 4261670 (-)
CI01000055_04274970_04286910 KIAA1033 coding upstream 198562 4274970 ~ 4287125 (-)
G241146 NA non-coding downstream 3093 4060517 ~ 4068333 (-)
G241061 NA non-coding downstream 34787 4029690 ~ 4036639 (-)
G241055 NA non-coding downstream 41765 4023186 ~ 4029661 (-)
G241051 NA non-coding downstream 82329 3988668 ~ 3989097 (-)
G241048 NA non-coding downstream 198369 3872743 ~ 3873057 (-)
G241132 NA non-coding upstream 144110 4220518 ~ 4221053 (-)
G241191 NA non-coding upstream 196627 4273035 ~ 4273278 (-)
G241215 NA non-coding upstream 278215 4354623 ~ 4355566 (-)
G241127 NA non-coding upstream 309309 4385717 ~ 4386121 (-)
G241223 NA non-coding upstream 325537 4401945 ~ 4402337 (-)
G240975 NA other downstream 337431 3717651 ~ 3733995 (-)
CI01000055_03616564_03618430 NA other downstream 451782 3616555 ~ 3618430 (-)
G240825 NA other downstream 853832 3216174 ~ 3217594 (-)
G240723 NA other downstream 1322074 2748835 ~ 2749352 (-)
CI01000055_04744063_04763284 FAM19A5, FAM19A5B other upstream 667298 4743706 ~ 4764067 (-)
CI01000055_05338403_05341971 NA other upstream 1257877 5338403 ~ 5341971 (-)
G241542 NA other upstream 1484935 5561343 ~ 5565783 (-)
G241646 NA other upstream 1765786 5842194 ~ 5847572 (-)
CI01000055_06036788_06037622 CARTPT, CART2 other upstream 1960176 6036472 ~ 6037728 (-)

Expression


Co-expression Network