G240071


Basic Information

Item Value
gene id G240071
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 5158732 ~ 5159015 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU272398
GTACACTTTTTTCTACCACATCTTTTCCTTCCCTTCGCCTCTCTATTAATGTGCTTGGACACAGAGCTCTGTGAACAGCCAGCCTCTTTTGCAATGAACTTTTGTGTCTTGCCCTCCTTGTGCAAGGTGTCAATGGTCGTCTTTTGGACAACTGTCAAGTCAGCAGTCTTCCCCATGATTGTGTAGCCTACAGAACTAGACTGAGAGACCATTTAAAGGCCTTTGCAGGTGTTTTGAGTTAACTAGCTGATTAGAGTGTGGCACCAGGTGTCTTCAATATTGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU272398 True 284 lncRNA 0.44 1 5158732 5159015

Neighbor

gene id symbol gene type direction distance location
CI01000055_05121603_05155153 GALNT18B, GALNT18A, GALNT18 coding upstream 3579 5121603 ~ 5155153 (+)
CI01000055_05086576_05086973 NA coding upstream 71351 5086026 ~ 5087381 (+)
CI01000055_05047161_05054848 VAC14 coding upstream 103283 5046159 ~ 5055449 (+)
CI01000055_04948850_04952489 NA coding upstream 206098 4948624 ~ 4952634 (+)
CI01000055_04920053_04936147 NA coding upstream 222138 4919069 ~ 4936594 (+)
CI01000055_05163240_05166231 PIGY, PYURF coding downstream 3975 5162990 ~ 5166647 (+)
CI01000055_05176060_05176484 NA coding downstream 16812 5175772 ~ 5176633 (+)
CI01000055_05183333_05195895 BTBD10B, BTBD10, BTBD10A coding downstream 24318 5183333 ~ 5196570 (+)
CI01000055_05212820_05215358 BORCS5 coding downstream 52456 5211471 ~ 5216143 (+)
CI01000055_05216403_05221104 NA coding downstream 57185 5216200 ~ 5221170 (+)
G240068 NA non-coding upstream 455 5157917 ~ 5158277 (+)
G240116 NA non-coding upstream 75986 5082532 ~ 5082746 (+)
G240077 NA non-coding upstream 122149 5036120 ~ 5036583 (+)
G240078 NA non-coding upstream 126533 5027070 ~ 5032199 (+)
G240143 NA non-coding downstream 9964 5168979 ~ 5169329 (+)
G240154 NA non-coding downstream 73799 5232814 ~ 5233313 (+)
G240163 NA non-coding downstream 87619 5246634 ~ 5251328 (+)
G240171 NA non-coding downstream 158271 5317286 ~ 5317495 (+)
CI01000055_04265119_04272728 NA other upstream 886017 4265119 ~ 4273913 (+)
G239755 NA other upstream 903640 4254210 ~ 4255092 (+)
G239761 NA other upstream 945330 4162250 ~ 4213402 (+)
CI01000055_02542526_02542861 NA other upstream 2614614 2542216 ~ 2544118 (+)
G238534 NA other upstream 3489488 1668410 ~ 1669244 (+)
G240099 NA other downstream 377503 5525472 ~ 5544153 (+)
CI01000055_05614889_05616453 NA other downstream 455363 5614065 ~ 5617591 (+)
CI01000055_06087070_06088629 ETFRF1, LYRM5, LYRM5B other downstream 927810 6087034 ~ 6088759 (+)
G240344 NA other downstream 1004845 6163860 ~ 6164011 (+)

Expression


Co-expression Network