G240453


Basic Information

Item Value
gene id G240453
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 6200138 ~ 6200482 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU272852
AATTAATTGAAAAAATAATGCTTGTTTGGCAATGCAAATTGGCAAGCTAAATTTTTAAAACATTCATTCTCTTATAACTTAAAATAAACATTCTTTGTAAAATTCTGTTGAACAATAAATATAATGCCTATTTATAAATATATTAGCCTACTGTATCATATTTAATATGCAAATTTCTAGGGCCTATAATTTATCAATGTGACCAAAACTTTGCTGAAAAATCTGTTGTACACAATCTACTTCATGCCTTCTGTCCTCTGATTGATAGTTCATACTTTTTTTTTAATCAAGTAAAGTTTTTTTTTGCTTATAAATTTGTAATGATTTTTATAAAGTAAATGTAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU272852 True 345 lncRNA 0.24 1 6200138 6200482

Neighbor

gene id symbol gene type direction distance location
CI01000055_06177831_06186773 MXG coding upstream 13365 6177831 ~ 6186773 (+)
CI01000055_06164325_06174472 MXG, MXD, MX2, MX, MX1 coding upstream 25375 6164325 ~ 6174763 (+)
CI01000055_06154806_06161718 NA coding upstream 38062 6154806 ~ 6162076 (+)
CI01000055_06148933_06151962 NA coding upstream 47933 6148684 ~ 6152205 (+)
CI01000055_06143884_06145039 NA coding upstream 54715 6142785 ~ 6145423 (+)
CI01000055_06233829_06238021 NA coding downstream 33347 6233829 ~ 6238021 (+)
CI01000055_06238643_06245138 NA coding downstream 38161 6238643 ~ 6245317 (+)
CI01000055_06247679_06298687 CELSR1B coding downstream 47197 6247679 ~ 6299580 (+)
CI01000055_06310117_06334586 GRAMD4B, GRAMD4 coding downstream 109635 6310117 ~ 6334801 (+)
CI01000055_06349198_06350625 KCNA6A coding downstream 147929 6348411 ~ 6351516 (+)
G240450 NA non-coding upstream 36467 6163361 ~ 6163671 (+)
G240444 NA non-coding upstream 63998 6135903 ~ 6136140 (+)
G240433 NA non-coding upstream 76456 6120554 ~ 6123682 (+)
G240432 NA non-coding upstream 80354 6119544 ~ 6119784 (+)
G240431 NA non-coding upstream 80984 6118918 ~ 6119154 (+)
G240358 NA non-coding downstream 130849 6331331 ~ 6333548 (+)
G240472 NA non-coding downstream 199511 6399993 ~ 6400807 (+)
G240473 NA non-coding downstream 200819 6401301 ~ 6401914 (+)
G240479 NA non-coding downstream 212372 6412854 ~ 6413389 (+)
G240344 NA other upstream 6238 6163860 ~ 6164011 (+)
CI01000055_06087070_06088629 ETFRF1, LYRM5, LYRM5B other upstream 111379 6087034 ~ 6088759 (+)
CI01000055_05614889_05616453 NA other upstream 582547 5614065 ~ 5617591 (+)
G240099 NA other upstream 656326 5525472 ~ 5544153 (+)
CI01000055_05163240_05166231 PIGY, PYURF other upstream 1033491 5162990 ~ 5166647 (+)

Expression


Co-expression Network