G240563


Basic Information

Item Value
gene id G240563
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 6670164 ~ 6670368 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU272993
GTTTGAATGTCCGCTGAGGAAAGCGATATCTTTTGTCTTTGTCCTTTTAACATTTAAGACATTCCCATGACAGCACTAGTCAATTTGTCAGTTGAGTCTTGTAAGATGTTGTTTTAGTCCATTTCAATATAAAAGTCTTTGCGACTGACTCACTCATAAAGACAGTCTTTGCTGCCATCTAATGGCGTATTAACGTAACTTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU272993 True 205 lncRNA 0.37 1 6670164 6670368

Neighbor

gene id symbol gene type direction distance location
CI01000055_06530845_06542679 NA coding upstream 127439 6529991 ~ 6542725 (+)
CI01000055_06513312_06529035 NA coding upstream 140654 6512366 ~ 6529510 (+)
CI01000055_06487661_06489302 NA coding upstream 180778 6487661 ~ 6490167 (+)
CI01000055_06472841_06481094 NA coding upstream 189008 6472841 ~ 6481156 (+)
CI01000055_06443549_06446405 BPGM coding upstream 223723 6443549 ~ 6446441 (+)
CI01000055_06716393_06716976 KXD1 coding downstream 46025 6716393 ~ 6716976 (+)
CI01000055_06718992_06719248 NA coding downstream 48624 6718992 ~ 6719559 (+)
CI01000055_06720233_06726592 ERGIC2 coding downstream 49502 6719870 ~ 6727509 (+)
G240561 NA non-coding upstream 12355 6657526 ~ 6657809 (+)
G240557 NA non-coding upstream 16462 6653494 ~ 6653702 (+)
G240555 NA non-coding upstream 18838 6651065 ~ 6651326 (+)
G240550 NA non-coding upstream 29050 6640628 ~ 6641114 (+)
G240565 NA non-coding downstream 2916 6673284 ~ 6673621 (+)
G240524 NA non-coding downstream 5799 6676167 ~ 6677490 (+)
G240584 NA non-coding downstream 83963 6754331 ~ 6754711 (+)
CI01000055_06310117_06334586 GRAMD4B, GRAMD4 other upstream 328999 6310117 ~ 6334801 (+)
G240344 NA other upstream 476264 6163860 ~ 6164011 (+)
CI01000055_06087070_06088629 ETFRF1, LYRM5, LYRM5B other upstream 581405 6087034 ~ 6088759 (+)
CI01000055_05614889_05616453 NA other upstream 1052573 5614065 ~ 5617591 (+)
G240099 NA other upstream 1126352 5525472 ~ 5544153 (+)

Expression


Co-expression Network