CI01000057_04042903_04046286 (CCL44)


Basic Information

Item Value
gene id CI01000057_04042903_04046286
gene name CCL44
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4042770 ~ 4046320 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000057_04042903_04046286.mRNA
AGAACGGAGGAAAAAATCCCTCTGAGGTTCCACCATGTTCCTGCAGACTGTCTCCATCCTCTTCCTCTCGGCCGTCCTCTTCGGCTGCCTGGAAGGGAAGGGTGTGCAAATGCAGCGAGATGTTCAGTGCTGCATGCAGTACTCTCAAGGCAAAGTCCGGACCAAAGACGTCCTGAGACTGTACACCAAAAAGGCGGTGAAGTGCGCTGATCCAAGAGACAGGAAGGTGAAGAGGTTACTACGGAAACTGAACCAGAGGATGGGAGCCAAATCCCACAGGACCATGTGGCCACATCGGCATATGAATCTGCCCGTCATGTCGGAGGTCGATGTTGTTAACTCCCAAAAGATGAACAAGCTATGTATAGTCTCTATAACTTATACAAGCTCTTCTATAGAGTCCAGTAAGCTGGTATGACTGTTCTCAAACAATTTATAGTGCAATTACAGAACCTCTTGTGTATGTTAAACACAACTGATTTTTATATATAAAAATAAAAGAAAAATATTGAAAATCATTTTGTTTTTATTGTAACAGACAAAAAATTAAA

Function

symbol description
ccl44 Predicted to enable CCR chemokine receptor binding activity and chemokine activity. Predicted to be involved in several processes, including cellular response to cytokine stimulus; leukocyte chemotaxis; and positive regulation of ERK1 and ERK2 cascade. Predicted to act upstream of or within immune response. Predicted to be located in extracellular region. Predicted to be active in extracellular space.

NR:

description
unnamed protein product

GO:

id name namespace
GO:0002548 monocyte chemotaxis biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000057_04042903_04046286.mRNA True 551 mRNA 0.43 5 4042770 4046320

Neighbor

gene id symbol gene type direction distance location
CI01000057_03995084_03999126 NA coding downstream 43607 3993890 ~ 3999163 (-)
CI01000057_03964894_03967760 PLVAP coding downstream 74033 3964455 ~ 3968737 (-)
CI01000057_03903266_03927695 ANO8, ANO8B coding downstream 115075 3902149 ~ 3927695 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 coding downstream 150716 3887203 ~ 3892054 (-)
CI01000057_03847471_03851892 GAMT coding downstream 190649 3847305 ~ 3852121 (-)
CI01000057_04055321_04058726 POLE4 coding upstream 8971 4055291 ~ 4059069 (-)
CI01000057_04145896_04146600 NRTN coding upstream 98944 4145264 ~ 4146790 (-)
CI01000057_04195849_04198909 NDUFA11 coding upstream 149475 4195795 ~ 4198909 (-)
CI01000057_04210090_04214161 NA coding upstream 163596 4209916 ~ 4214161 (-)
CI01000057_04455612_04467173 DDX49, DDX49.S coding upstream 408714 4455034 ~ 4467217 (-)
G246407 NA non-coding downstream 50894 3991561 ~ 3991876 (-)
G246278 NA non-coding downstream 226427 3815644 ~ 3816343 (-)
G246295 NA non-coding downstream 227210 3814101 ~ 3815560 (-)
G246363 NA non-coding downstream 278068 3764262 ~ 3764702 (-)
G246429 NA non-coding upstream 15303 4061623 ~ 4140129 (-)
G246279 NA non-coding upstream 148704 4195024 ~ 4195559 (-)
G246281 NA non-coding upstream 161643 4207963 ~ 4208933 (-)
G246474 NA non-coding upstream 163037 4209357 ~ 4209730 (-)
G246488 NA non-coding upstream 201204 4247524 ~ 4247797 (-)
CI01000057_01904867_01921400 NA other downstream 2121349 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 2237617 1801528 ~ 1806454 (-)
G244358 NA other downstream 3471742 570530 ~ 571028 (-)
CI01000057_04927533_04931127 CDK4 other upstream 882424 4927533 ~ 4931420 (-)
G246780 NA other upstream 1164790 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 1877220 5923540 ~ 5927295 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location