G244370


Basic Information

Item Value
gene id G244370
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 632576 ~ 632905 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU277393
TAACACACTTTAAAATAATTGTACTTTAGTATATTTTCTAAAAAATATATTTTAGAAAAATATACTTGAAGTGTAAGTTCAGTTCATTTTTTAAAAGTGTATTTATTTGCACTTTATAAAAATATATTTGAGGTATATTTTAACTGTGTGCTGAAAATGATCATTGTAACAATGCACTGTAAGTATATTTAAATACATTATTTAATATCCTGAAGTTGTAGTGTATTTAAAGTTAAATTTGAGTATATTTTTTAAGTTTAGTTATTCATCCTTGGAATTCATTTTATTACTTGTGCTTATTTATTTCAGTATGACTAATGCATAAAAAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU277393 True 330 lncRNA 0.21 1 632576 632905

Neighbor

gene id symbol gene type direction distance location
CI01000057_00628126_00628851 NA coding downstream 2410 627715 ~ 630166 (-)
CI01000057_00561471_00562830 NA coding downstream 69719 561229 ~ 562857 (-)
CI01000057_00534471_00559759 NA coding downstream 72817 533588 ~ 559759 (-)
CI01000057_00475661_00476027 NA coding downstream 156549 475392 ~ 476027 (-)
CI01000057_00459703_00467870 ABHD6A, ABHD6 coding downstream 164706 458943 ~ 467870 (-)
CI01000057_00873279_00873578 NA coding upstream 240369 873274 ~ 873578 (-)
CI01000057_00938618_00949690 NA coding upstream 305166 938071 ~ 949779 (-)
CI01000057_00956994_00965947 NR1D4B coding upstream 322728 955633 ~ 965947 (-)
CI01000057_01083731_01092073 NA coding upstream 450809 1083714 ~ 1092631 (-)
CI01000057_01145522_01147560 NA coding upstream 511157 1144062 ~ 1147772 (-)
G244367 NA non-coding downstream 1137 631120 ~ 631439 (-)
G244360 NA non-coding downstream 56431 575867 ~ 576145 (-)
G244359 NA non-coding downstream 57691 574536 ~ 574885 (-)
G244339 NA non-coding downstream 152159 480197 ~ 480417 (-)
G244338 NA non-coding downstream 152422 479943 ~ 480154 (-)
G244380 NA non-coding upstream 121025 753930 ~ 759844 (-)
G244391 NA non-coding upstream 204656 837561 ~ 838099 (-)
G244462 NA non-coding upstream 205230 838135 ~ 839154 (-)
G244463 NA non-coding upstream 207891 840796 ~ 841279 (-)
G244465 NA non-coding upstream 212937 845842 ~ 847479 (-)
G244358 NA other downstream 61548 570530 ~ 571028 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other upstream 1168679 1801528 ~ 1806454 (-)
CI01000057_01904867_01921400 NA other upstream 1287151 1904533 ~ 1921905 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 3258830 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 4295839 4927533 ~ 4931420 (-)
G246780 NA other upstream 4578205 5086312 ~ 5283617 (-)

Expression


Co-expression Network