G244724



Basic Information


Item Value
gene id G244724
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 1531913 ~ 1532209 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU277831
ATCACTTTATTAAATTTCTGTACCTGAAAATTGTGAATTTTCAGTGGTATCTAAAAAATTGGTGTCATAACTAACATTTTTTTTGTAATACATACCCCCACTCAATAACATGAGATTCATAATCCCAGTATTCTCTGGGCCGGTGCGTGTTCACCTCAGTGTAGACTCTGGCACGACTCGCCACAGGTCCTGACATGACACACAGTTTGACACTGTGTTTACTATAATTCCAATTAAAAATCAGATGGGAAAACACAAACAGCTGTGCTGAAGGCCACAGAAGATGGAAGGACCTCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU277831 True 297 lncRNA 0.39 1 1531913 1532209

Neighbor


gene id symbol gene type direction distance location
CI01000057_01471460_01487413 NA coding downstream 44151 1471127 ~ 1487762 (-)
CI01000057_01356170_01359401 NA coding downstream 171943 1355409 ~ 1359970 (-)
CI01000057_01261251_01262315 NA coding downstream 269598 1260686 ~ 1262315 (-)
CI01000057_01252690_01256408 ZNF740A coding downstream 275505 1252647 ~ 1256408 (-)
CI01000057_01235433_01244747 NA coding downstream 286731 1235177 ~ 1245182 (-)
CI01000057_01542990_01546030 SLC2A10 coding upstream 10588 1542797 ~ 1546030 (-)
CI01000057_01559593_01572133 NA coding upstream 27338 1559547 ~ 1572850 (-)
CI01000057_01707526_01708449 NA coding upstream 175286 1707495 ~ 1708449 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A coding upstream 269319 1801528 ~ 1806454 (-)
CI01000057_01904867_01921400 NA coding upstream 372324 1904533 ~ 1921905 (-)
G244732 NA non-coding downstream 1116 1530593 ~ 1530797 (-)
G244731 NA non-coding downstream 2576 1528941 ~ 1529337 (-)
G244730 NA non-coding downstream 3200 1528032 ~ 1528713 (-)
G244720 NA non-coding downstream 7928 1512983 ~ 1523985 (-)
G244706 NA non-coding downstream 83231 1448343 ~ 1448682 (-)
G244722 NA non-coding upstream 3421 1535630 ~ 1535921 (-)
G244734 NA non-coding upstream 27590 1559799 ~ 1560502 (-)
G244736 NA non-coding upstream 31005 1563214 ~ 1563431 (-)
G244738 NA non-coding upstream 32012 1564221 ~ 1564509 (-)
G244740 NA non-coding upstream 37839 1570048 ~ 1570261 (-)
G244358 NA other downstream 960885 570530 ~ 571028 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 2359526 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 3396535 4927533 ~ 4931420 (-)
G246780 NA other upstream 3678901 5086312 ~ 5283617 (-)

Expression



Co-expression Network