G244913


Basic Information

Item Value
gene id G244913
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 2105184 ~ 2105429 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278030
CGCCACGCATTATGTAATCACGGTGGAAAGGTCACGCGTGACGTAGGTGATAGTACCACGGTAGAGCGAAAAACTAAATCTCATTCTCTCCTCCAACTTAAAAATAGTCTGACATCATTGTTTTACCTTTTTTTGTAAAGGGCACGTTCGCTTTGTAGACACTGGATCGGTACTTCCGCCTACCGCGTGACCTTTCCAATGTGATTATGTAATGCGTGGCGCATCGCAGAGCAGTGCAAGATGATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278030 True 246 lncRNA 0.46 1 2105184 2105429

Neighbor

gene id symbol gene type direction distance location
CI01000057_01904867_01921400 NA coding downstream 183279 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A coding downstream 298730 1801528 ~ 1806454 (-)
CI01000057_01707526_01708449 NA coding downstream 396735 1707495 ~ 1708449 (-)
CI01000057_01559593_01572133 NA coding downstream 532334 1559547 ~ 1572850 (-)
CI01000057_01542990_01546030 SLC2A10 coding downstream 559154 1542797 ~ 1546030 (-)
CI01000057_02200951_02207673 CDK2.S, CDK2, MGC81499 coding upstream 95151 2200580 ~ 2207673 (-)
CI01000057_02248495_02254279 NA coding upstream 142917 2248346 ~ 2254318 (-)
CI01000057_02258394_02291730 ACAP3B, CENB5, ACAP3 coding upstream 152965 2258394 ~ 2291730 (-)
CI01000057_02374706_02384095 DDX19A, DDX19B, RP11-529K1.3, DDX19 coding upstream 269120 2374549 ~ 2384849 (-)
CI01000057_02401903_02408835 NA coding upstream 296391 2401820 ~ 2411148 (-)
G244886 NA non-coding downstream 27660 2055118 ~ 2077524 (-)
G244814 NA non-coding downstream 194215 1834717 ~ 1910969 (-)
G244813 NA non-coding downstream 271581 1833351 ~ 1833603 (-)
G244812 NA non-coding downstream 272128 1832592 ~ 1833056 (-)
G244811 NA non-coding downstream 272828 1830318 ~ 1832356 (-)
G244910 NA non-coding upstream 3663 2109092 ~ 2111515 (-)
G244914 NA non-coding upstream 6923 2112352 ~ 2112664 (-)
G244915 NA non-coding upstream 8516 2113945 ~ 2114154 (-)
G244916 NA non-coding upstream 17296 2122725 ~ 2148104 (-)
G244922 NA non-coding upstream 29245 2134674 ~ 2135249 (-)
G244358 NA other downstream 1534156 570530 ~ 571028 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 1786306 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 2823315 4927533 ~ 4931420 (-)
G246780 NA other upstream 3105681 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 3818111 5923540 ~ 5927295 (-)

Expression


Co-expression Network