G244939


Basic Information

Item Value
gene id G244939
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 2208930 ~ 2209229 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278061
TGTCGCGAGGGCGTGTTGTTTGAAACGCGGGAATTGGCGTTATTGATGTTAAGTTGTGATATGACTTTCGGTTGCCTGTTTTTTTACGTATTAAATAAACGATTTTAATGTTTCTGATCGTCGTTGTGCAACTAAAAGTGCTCTCGCCAACACATTTGTTGTTTTAAATAGATTTAGAGTGGAAGTTTCCCCGGAAAAGGGGGAGTTTGACATGGAGTCCTTTCAGAAAGTGGAAAAGATTGGAGAGGGGACATATGGGGTGGTTTATAAAGCCAAGAATAAAATCACTGGAGAGACTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278061 True 300 lncRNA 0.40 1 2208930 2209229

Neighbor

gene id symbol gene type direction distance location
CI01000057_02200951_02207673 CDK2.S, CDK2, MGC81499 coding downstream 1257 2200580 ~ 2207673 (-)
CI01000057_01904867_01921400 NA coding downstream 287025 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A coding downstream 402476 1801528 ~ 1806454 (-)
CI01000057_01707526_01708449 NA coding downstream 500481 1707495 ~ 1708449 (-)
CI01000057_01559593_01572133 NA coding downstream 636080 1559547 ~ 1572850 (-)
CI01000057_02248495_02254279 NA coding upstream 39117 2248346 ~ 2254318 (-)
CI01000057_02258394_02291730 ACAP3B, CENB5, ACAP3 coding upstream 49165 2258394 ~ 2291730 (-)
CI01000057_02374706_02384095 DDX19A, DDX19B, RP11-529K1.3, DDX19 coding upstream 165320 2374549 ~ 2384849 (-)
CI01000057_02401903_02408835 NA coding upstream 192591 2401820 ~ 2411148 (-)
CI01000057_02421510_02433767 NA coding upstream 211995 2421224 ~ 2433767 (-)
G244930 NA non-coding downstream 38197 2170362 ~ 2170733 (-)
G244928 NA non-coding downstream 50810 2157913 ~ 2158120 (-)
G244916 NA non-coding downstream 60826 2122725 ~ 2148104 (-)
G244922 NA non-coding downstream 73681 2134674 ~ 2135249 (-)
G244915 NA non-coding downstream 94776 2113945 ~ 2114154 (-)
G244963 NA non-coding upstream 25586 2234815 ~ 2235090 (-)
G244941 NA non-coding upstream 38184 2247413 ~ 2247724 (-)
G244949 NA non-coding upstream 130902 2340131 ~ 2341614 (-)
G244971 NA non-coding upstream 139258 2348487 ~ 2348796 (-)
G244967 NA non-coding upstream 150927 2360156 ~ 2360434 (-)
G244358 NA other downstream 1637902 570530 ~ 571028 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 1682506 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 2719515 4927533 ~ 4931420 (-)
G246780 NA other upstream 3001881 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 3714311 5923540 ~ 5927295 (-)

Expression


Co-expression Network