G244941


Basic Information

Item Value
gene id G244941
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 2247413 ~ 2247724 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278063
GGACAGGAAGCCTGACTGAAGCAGCTGATAATCAGGCTTTGGATGTTCCGGGGAGCACAACAGCCTCTTTCTGCCTGGATTTTAATCAGGTTTATTTTTAGTACAAGGACAGAAATCGACGATTTTATGAGCAGTGGCATCGGTCACGCTTGACAGTGACTGATGGAGCTGTATTTTTATACCGATCGCTGTATATTTTCGAGTTAACTGTTGGGCCGGAGGAGCTTTGTAACAATGAAGGCCTAGAATCCAGATCCGAGGGATTTAAAGCTCTCCTCTGTCCCAGACACAAGGATCAACAACACGCTCAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278063 True 312 lncRNA 0.46 1 2247413 2247724

Neighbor

gene id symbol gene type direction distance location
CI01000057_02200951_02207673 CDK2.S, CDK2, MGC81499 coding downstream 39740 2200580 ~ 2207673 (-)
CI01000057_01904867_01921400 NA coding downstream 325508 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A coding downstream 440959 1801528 ~ 1806454 (-)
CI01000057_01707526_01708449 NA coding downstream 538964 1707495 ~ 1708449 (-)
CI01000057_01559593_01572133 NA coding downstream 674563 1559547 ~ 1572850 (-)
CI01000057_02248495_02254279 NA coding upstream 622 2248346 ~ 2254318 (-)
CI01000057_02258394_02291730 ACAP3B, CENB5, ACAP3 coding upstream 10670 2258394 ~ 2291730 (-)
CI01000057_02374706_02384095 DDX19A, DDX19B, RP11-529K1.3, DDX19 coding upstream 126825 2374549 ~ 2384849 (-)
CI01000057_02401903_02408835 NA coding upstream 154096 2401820 ~ 2411148 (-)
CI01000057_02421510_02433767 NA coding upstream 173500 2421224 ~ 2433767 (-)
G244963 NA non-coding downstream 12323 2234815 ~ 2235090 (-)
G244939 NA non-coding downstream 38184 2208930 ~ 2209229 (-)
G244930 NA non-coding downstream 76680 2170362 ~ 2170733 (-)
G244928 NA non-coding downstream 89293 2157913 ~ 2158120 (-)
G244916 NA non-coding downstream 99309 2122725 ~ 2148104 (-)
G244949 NA non-coding upstream 92407 2340131 ~ 2341614 (-)
G244971 NA non-coding upstream 100763 2348487 ~ 2348796 (-)
G244967 NA non-coding upstream 112432 2360156 ~ 2360434 (-)
G244979 NA non-coding upstream 144491 2392215 ~ 2392503 (-)
G244944 NA non-coding upstream 145010 2392734 ~ 2396427 (-)
G244358 NA other downstream 1676385 570530 ~ 571028 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 1644011 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 2681020 4927533 ~ 4931420 (-)
G246780 NA other upstream 2963386 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 3675816 5923540 ~ 5927295 (-)

Expression


Co-expression Network