G245034


Basic Information

Item Value
gene id G245034
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 2686859 ~ 2687100 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278169
CTAACCAGTTACGCAGTTTTACTGTCATTAACTGAATATTTAAAACTAAAACTTAAAGTCCTGGTTTCAGAGACAGGGCTTAGATTAAGCCAGGATAGGGCCTTAGTTTAAATAGGGCATCTAAGTAGCTTTTATAAACATGCCTCAGAAAAAAACATCACTGGCGTGCATCTTGAGACAAAGCAATGACACTGACATATTTTAAGATATGCCAGTGCAAGTTGCTTTCAGTTAAAACAGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278169 True 242 lncRNA 0.37 1 2686859 2687100

Neighbor

gene id symbol gene type direction distance location
CI01000057_02624690_02627558 GATA2 coding downstream 56637 2624461 ~ 2630222 (-)
CI01000057_02621058_02622618 NA coding downstream 64010 2620915 ~ 2622849 (-)
CI01000057_02457005_02470094 NA coding downstream 216765 2456813 ~ 2470094 (-)
CI01000057_02439034_02454810 NA coding downstream 232049 2437622 ~ 2454810 (-)
CI01000057_02421510_02433767 NA coding downstream 253092 2421224 ~ 2433767 (-)
CI01000057_02701515_02705729 GLT8D1 coding upstream 13783 2700883 ~ 2705729 (-)
CI01000057_02710209_02720000 NEK4 coding upstream 23064 2710164 ~ 2721575 (-)
CI01000057_02807951_02821617 CCDC3B coding upstream 120666 2807766 ~ 2821793 (-)
CI01000057_02829879_02834139 NA coding upstream 142734 2829834 ~ 2834262 (-)
CI01000057_02838008_02838430 NA coding upstream 149609 2836677 ~ 2838785 (-)
G245024 NA non-coding downstream 90342 2596206 ~ 2596517 (-)
G245016 NA non-coding downstream 109627 2576996 ~ 2577232 (-)
G245015 NA non-coding downstream 109970 2576453 ~ 2576889 (-)
G244982 NA non-coding downstream 272674 2413937 ~ 2414185 (-)
G244944 NA non-coding downstream 290432 2392734 ~ 2396427 (-)
G245035 NA non-coding upstream 550 2687650 ~ 2687865 (-)
G245069 NA non-coding upstream 163720 2850820 ~ 2869408 (-)
G245130 NA non-coding upstream 215965 2903065 ~ 2903273 (-)
G245996 NA non-coding upstream 303892 2990992 ~ 2991334 (-)
CI01000057_01904867_01921400 NA other downstream 765438 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 881706 1801528 ~ 1806454 (-)
G244358 NA other downstream 2115831 570530 ~ 571028 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 1204635 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 2241644 4927533 ~ 4931420 (-)
G246780 NA other upstream 2524010 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 3236440 5923540 ~ 5927295 (-)

Expression


Co-expression Network