G246488


Basic Information

Item Value
gene id G246488
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4247524 ~ 4247797 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU279744
CACTGAAGCAGAGTTAAAGTTTATGAGATAATATACTTTTTGTGGAGTTGTTTATTCAGATCTTGAGAGATTTAATGTCTTTTATCTTCAGTTGATTTCATTTAAGGCTATGGCTGGAAGTCATTTGTAGTTATTGTGTTTCTCTTCAGTGATTCTGCTTGTTAACAGCAGGTGTTCATCACTAATGCTCAATCATAACTTAATTAATCACTTAATTATCTCATTAACTTTAACTCTGCTTCAGTGTTACTTTAACACTATATAGAGAGGGACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU279744 True 274 lncRNA 0.32 1 4247524 4247797

Neighbor

gene id symbol gene type direction distance location
CI01000057_04210090_04214161 NA coding downstream 33363 4209916 ~ 4214161 (-)
CI01000057_04195849_04198909 NDUFA11 coding downstream 48615 4195795 ~ 4198909 (-)
CI01000057_04145896_04146600 NRTN coding downstream 100734 4145264 ~ 4146790 (-)
CI01000057_04055321_04058726 POLE4 coding downstream 188455 4055291 ~ 4059069 (-)
CI01000057_04042903_04046286 CCL44 coding downstream 201204 4042770 ~ 4046320 (-)
CI01000057_04455612_04467173 DDX49, DDX49.S coding upstream 207237 4455034 ~ 4467217 (-)
CI01000057_04467496_04467864 NA coding upstream 219676 4467473 ~ 4468001 (-)
CI01000057_04512368_04525620 COMP coding upstream 264080 4511877 ~ 4525620 (-)
CI01000057_04543887_04545600 NA coding upstream 295074 4542871 ~ 4546001 (-)
CI01000057_04560576_04573644 NA coding upstream 311843 4559640 ~ 4573644 (-)
G246474 NA non-coding downstream 37794 4209357 ~ 4209730 (-)
G246281 NA non-coding downstream 38591 4207963 ~ 4208933 (-)
G246279 NA non-coding downstream 51965 4195024 ~ 4195559 (-)
G246429 NA non-coding downstream 107395 4061623 ~ 4140129 (-)
G246407 NA non-coding downstream 255648 3991561 ~ 3991876 (-)
G246497 NA non-coding upstream 14077 4261874 ~ 4262549 (-)
G246292 NA non-coding upstream 29602 4277399 ~ 4278950 (-)
G246289 NA non-coding upstream 32781 4280578 ~ 4283109 (-)
G246519 NA non-coding upstream 96413 4344210 ~ 4345741 (-)
G246546 NA non-coding upstream 134901 4382698 ~ 4433790 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other downstream 349833 3887203 ~ 3892054 (-)
CI01000057_01904867_01921400 NA other downstream 2326103 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 2442371 1801528 ~ 1806454 (-)
G244358 NA other downstream 3676496 570530 ~ 571028 (-)
CI01000057_04927533_04931127 CDK4 other upstream 680947 4927533 ~ 4931420 (-)
G246780 NA other upstream 963313 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 1675743 5923540 ~ 5927295 (-)

Expression


Co-expression Network