G246632


Basic Information

Item Value
gene id G246632
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4597952 ~ 4598294 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU279908
GTGCAATTGATCTGATATGAGATGCATTATGTGAATGCTTGGCTGAAGAGATGTGTCTTTAATCTAGATTTAAACTGGGTGAGCGAGTCTGAGCCCCGAACATTATCAGGAAGGCTATTCCAGAGTTTAGGAGCCAAATGTGAAAACGCTCTCCCTCCTTTAGAGGACTTAGCTATCCTAGGTACAACCAGAAGTCCAGAGTTTTGTGATCTTAAAGAGCGTGAAGGATTGTAGGGCGATAGAAGATCGGTTAAGTACACAGGAGCTAAACCACTTAGAGCCTTATAGGTCATTAGCAGTACTTTATAATCGATACGGAACTTAATAGGTAACCAGTGAAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU279908 True 343 lncRNA 0.42 1 4597952 4598294

Neighbor

gene id symbol gene type direction distance location
CI01000057_04597494_04597814 NA coding downstream 138 4597415 ~ 4597814 (-)
CI01000057_04583096_04590861 ISY1 coding downstream 7091 4582911 ~ 4590861 (-)
CI01000057_04560576_04573644 NA coding downstream 24308 4559640 ~ 4573644 (-)
CI01000057_04543887_04545600 NA coding downstream 51951 4542871 ~ 4546001 (-)
CI01000057_04512368_04525620 COMP coding downstream 72332 4511877 ~ 4525620 (-)
CI01000057_04635274_04644405 NA coding upstream 36923 4635217 ~ 4644405 (-)
CI01000057_04647822_04649004 NPFFL coding upstream 49479 4647773 ~ 4649004 (-)
CI01000057_04657451_04663499 NRAMP-BETA, SLC11A2, NRAMP-ALPHA coding upstream 58968 4657262 ~ 4663499 (-)
CI01000057_04718947_04721031 NA coding upstream 120624 4718918 ~ 4721076 (-)
CI01000057_04728914_04731946 NA coding upstream 130578 4728872 ~ 4733723 (-)
G246587 NA non-coding downstream 38515 4557111 ~ 4559437 (-)
G246603 NA non-coding downstream 40942 4556726 ~ 4557010 (-)
G246597 NA non-coding downstream 63584 4532796 ~ 4534368 (-)
G246611 NA non-coding downstream 100283 4487312 ~ 4497669 (-)
G246617 NA non-coding downstream 101494 4495587 ~ 4496458 (-)
G246600 NA non-coding upstream 56683 4654977 ~ 4655439 (-)
G246658 NA non-coding upstream 115797 4714091 ~ 4714359 (-)
G246662 NA non-coding upstream 126222 4724516 ~ 4725178 (-)
G246669 NA non-coding upstream 151521 4749815 ~ 4750141 (-)
G246676 NA non-coding upstream 182472 4780766 ~ 4781052 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other downstream 700261 3887203 ~ 3892054 (-)
CI01000057_01904867_01921400 NA other downstream 2676531 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 2792799 1801528 ~ 1806454 (-)
G244358 NA other downstream 4026924 570530 ~ 571028 (-)
CI01000057_04927533_04931127 CDK4 other upstream 330450 4927533 ~ 4931420 (-)
G246780 NA other upstream 612816 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 1325246 5923540 ~ 5927295 (-)

Expression


Co-expression Network