CI01000058_03066079_03101574 (MAPKAPK2.S, MAPKAPK2, MAPKAPK2A)


Basic Information

Item Value
gene id CI01000058_03066079_03101574
gene name MAPKAPK2.S, MAPKAPK2, MAPKAPK2A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 3066079 ~ 3101574 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000058_03066079_03101574.mRNA
ATGTTGACTAACGCCAACAGTCCGCCGAAGTTTCCAAACCAGCAACAGCAGCAACAACAGAATCCAGCCCAATTCGTGTTGGGAAAAGCCTCACTTCAGATCAAGAAAAATGCCATAATCGACGAATACAAGGTCACTAGTCAAGTACTGGGACTGGGCATCAATGGCAGGGTACTGGAGATCTTTCACAAGAGGAGTGGGGAAAAGTATGCTTTAAAGATGCTTCATGATTGTCCCAAAGCTAGAAGAGAGGTGGAAATGCACTGGCGGGCTTCCTCCTGTACCCACATCGTCAGAATTGTTGACGTCTATGAAAATCTCTACCAAAACAGGAAGTGCCTTCTTATTGTAATGGAGTGCATGGATGGAGGTGAGCTGTTCAGTCGGATTCAGGACAGAGGGGACCAGGCATTCACTGAGAGA

Function

symbol description
mapkapk2a Enables kinase activity. Acts upstream of or within epiboly involved in gastrulation with mouth forming second. Predicted to be active in cytoplasm and nucleus. Orthologous to human MAPKAPK2 (MAPK activated protein kinase 2).
mapkapk2 Enables protein serine/threonine kinase activity. Involved in several processes, including peptidyl-serine phosphorylation; regulation of gene expression; and vascular endothelial growth factor receptor signaling pathway. Located in centrosome; cytoplasm; and nucleoplasm.

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0000187 activation of MAPK activity biological_process

KEGG:

id description
K04443 MAPKAPK2; mitogen-activated protein kinase-activated protein kinase 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000058_03066079_03101574.mRNA True 423 mRNA 0.47 3 3066079 3101574

Neighbor

gene id symbol gene type direction distance location
CI01000058_03034418_03038200 DYRK3 coding upstream 27735 3034418 ~ 3038344 (+)
CI01000058_02979997_03027744 RASSF5 coding upstream 37935 2979997 ~ 3028144 (+)
CI01000058_02964886_02978501 IKBKE coding upstream 87184 2964886 ~ 2978895 (+)
CI01000058_02911431_02958568 SRGAP2 coding upstream 107511 2911431 ~ 2958568 (+)
CI01000058_02883775_02884290 NA coding upstream 180375 2882164 ~ 2885704 (+)
CI01000058_03169524_03172961 FMODA coding downstream 67471 3169045 ~ 3173702 (+)
CI01000058_03181624_03193630 SLC6A14 coding downstream 79846 3181420 ~ 3195924 (+)
CI01000058_03201861_03220295 TAF4A, TAF4 coding downstream 99408 3200982 ~ 3220724 (+)
CI01000058_03503653_03506062 NA coding downstream 401804 3503378 ~ 3506296 (+)
CI01000058_03644271_03645229 NA coding downstream 542697 3644271 ~ 3645229 (+)
G248594 NA non-coding upstream 101256 2964493 ~ 2964823 (+)
G248566 NA non-coding upstream 157882 2891351 ~ 2908197 (+)
G248574 NA non-coding upstream 187291 2867222 ~ 2878788 (+)
G248519 NA non-coding upstream 380445 2685275 ~ 2685634 (+)
G248516 NA non-coding upstream 392417 2673375 ~ 2673662 (+)
G248613 NA non-coding downstream 6199 3107773 ~ 3108154 (+)
G248614 NA non-coding downstream 7435 3109009 ~ 3109249 (+)
G248568 NA non-coding downstream 10210 3111784 ~ 3114371 (+)
G248618 NA non-coding downstream 17494 3119068 ~ 3119298 (+)
G248560 NA non-coding downstream 34724 3136298 ~ 3141022 (+)
CI01000058_01794468_01800421 KISS1 other upstream 1268347 1794468 ~ 1800421 (+)
G247940 NA other upstream 1609632 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 1777809 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 2468908 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 2610335 434913 ~ 455744 (+)
G250039 NA other downstream 1592834 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 1724802 4864571 ~ 4888216 (+)

Expression


Co-expression Network