G247624



Basic Information


Item Value
gene id G247624
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 732079 ~ 732345 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU281065
CTTAGCTGTCGGACGACGTCTTCAATCATCAGCATCGCAAACATTGCGTTGCCGCGGTGGGGAGGACGACGCGCCGATCAGCATTACTACAGCAGTGAGTTTTTTTTTTCTGCGCCACGGTGCGAAGCGACCATTGTGTTTAAGTTCTCCCCGCTCTCAAGCAACGCTACAGGCCTGCACCGTGTCCAACTCTGACTGTCCGGGTATTCATTTTATTTAATCGAGTGGCCATTTAGTCATTTTGCCGGCTTAGTTTTAATTTTGTGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU281065 True 267 lncRNA 0.50 1 732079 732345

Neighbor


gene id symbol gene type direction distance location
CI01000058_00694430_00713270 ADGRL4 coding downstream 18809 694339 ~ 713270 (-)
CI01000058_00673067_00690079 NA coding downstream 41984 672218 ~ 690095 (-)
CI01000058_00665144_00668842 NA coding downstream 63237 665036 ~ 668842 (-)
CI01000058_00599524_00634109 APC2 coding downstream 97970 599179 ~ 634109 (-)
CI01000058_00570327_00573074 NA coding downstream 159005 570273 ~ 573074 (-)
CI01000058_00958655_00993242 NA coding upstream 226276 958621 ~ 1025837 (-)
CI01000058_01143391_01218374 TTLL7 coding upstream 410999 1143344 ~ 1218374 (-)
CI01000058_01273319_01276576 UOX coding upstream 540923 1273268 ~ 1276977 (-)
CI01000058_01292655_01293207 NA coding upstream 559641 1291960 ~ 1293207 (-)
CI01000058_01317202_01318789 NA coding upstream 584785 1317130 ~ 1320180 (-)
G247618 NA non-coding downstream 4277 727438 ~ 727802 (-)
G247601 NA non-coding downstream 60723 671096 ~ 671356 (-)
G247524 NA non-coding downstream 153641 578220 ~ 578438 (-)
G247520 NA non-coding downstream 166464 565032 ~ 565615 (-)
G247522 NA non-coding downstream 167916 563667 ~ 564163 (-)
G247725 NA non-coding upstream 21549 753894 ~ 754675 (-)
G247726 NA non-coding upstream 23160 755505 ~ 755727 (-)
G247727 NA non-coding upstream 24088 756433 ~ 756646 (-)
G247734 NA non-coding upstream 53523 785868 ~ 786154 (-)
G247737 NA non-coding upstream 60994 793339 ~ 793620 (-)
G247592 NA other downstream 77130 646443 ~ 654949 (-)
CI01000058_02859435_02860658 FAM72A other upstream 2126138 2858483 ~ 2861491 (-)
G250230 NA other upstream 2956298 3688643 ~ 3696711 (-)

Expression



Co-expression Network