G248031


Basic Information

Item Value
gene id G248031
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 1403384 ~ 1403656 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281520
TGTAAACAACTTTTGTGTCTTTATCAGCTTTTCTGCATATATACTGGCCCTGACAATCATCACACATGCACTTACCGCTTGCTCCATTAATGTAAATCCGTTTTAATGAATGAATGACTCTTGCTACCCATCGCTCTGCTCTTCGTCAACATGCGCTTGCACCACCTGCTGGTGAGGTCGACTAACAGCAGATGGAGACTATGCTAGGTACTCTACTGCTTGTCCTGCAGTTCCTGGATGTGAAATGTTGAAATTTGAAACACTGAATTTGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281520 True 273 lncRNA 0.43 1 1403384 1403656

Neighbor

gene id symbol gene type direction distance location
CI01000058_01391493_01394283 NA coding upstream 8965 1391493 ~ 1394419 (+)
CI01000058_01384467_01388274 NA coding upstream 14457 1384204 ~ 1388927 (+)
CI01000058_01364846_01374544 NA coding upstream 28800 1364846 ~ 1374584 (+)
CI01000058_01348684_01352173 NA coding upstream 50796 1348684 ~ 1352588 (+)
CI01000058_01298298_01311989 BMP7A coding upstream 90338 1298076 ~ 1313046 (+)
CI01000058_01431719_01434294 CHIA.2 coding downstream 27903 1431559 ~ 1434513 (+)
CI01000058_01496481_01498802 NA coding downstream 91214 1494870 ~ 1499810 (+)
CI01000058_01580247_01591754 NA coding downstream 176007 1579663 ~ 1592253 (+)
CI01000058_01625351_01664692 PIK3C2B coding downstream 221695 1625351 ~ 1665794 (+)
CI01000058_01740599_01784355 PLEKHA6 coding downstream 336943 1740599 ~ 1784676 (+)
G248027 NA non-coding upstream 2116 1400988 ~ 1401268 (+)
G247960 NA non-coding upstream 72524 1303301 ~ 1330860 (+)
CI01000058_01280337_01289153 DNASE2B non-coding upstream 112897 1278592 ~ 1289874 (+)
CI01000058_01266712_01271962 SAMD13 non-coding upstream 128947 1265753 ~ 1274437 (+)
G247917 NA non-coding upstream 154480 1221593 ~ 1248904 (+)
G248035 NA non-coding downstream 3000 1406656 ~ 1407006 (+)
G248036 NA non-coding downstream 5446 1409102 ~ 1409884 (+)
G247934 NA non-coding downstream 58627 1462283 ~ 1465887 (+)
G248052 NA non-coding downstream 63981 1467637 ~ 1503560 (+)
G247993 NA non-coding downstream 88523 1492179 ~ 1550850 (+)
CI01000058_00592498_00596709 NA other upstream 806213 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 947640 434913 ~ 455744 (+)
G247940 NA other downstream 49341 1452997 ~ 1456447 (+)
CI01000058_01794468_01800421 KISS1 other downstream 392057 1794468 ~ 1800421 (+)
G250039 NA other downstream 3290752 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 3422720 4864571 ~ 4888216 (+)

Expression


Co-expression Network