G248140


Basic Information

Item Value
gene id G248140
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 1859734 ~ 1859980 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281647
TCTCAGAGTGATGATAATTAATGTCCCCGACTGCCTGTGTAGTCCCATTTAGCCACTTGTTAGCAACCGCCTTTTTCAAGACACATAACAGCTTAAAAAAAAATCACGTGGGGTAATAAGTGGGGTAATACTGATGCATTTTATGTTGTAGAATAAAACGTGAAACTGTCTTGAGCTTGTGTTCACCACAGACCTTATTTCAGCCATTTAACCAAAATCCCATTCAAAAAATCCATTGACTTCGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281647 True 247 lncRNA 0.39 1 1859734 1859980

Neighbor

gene id symbol gene type direction distance location
CI01000058_01838039_01842964 NA coding upstream 16504 1838039 ~ 1843230 (+)
CI01000058_01794468_01800421 KISS1 coding upstream 59313 1794468 ~ 1800421 (+)
CI01000058_01740599_01784355 PLEKHA6 coding upstream 75058 1740599 ~ 1784676 (+)
CI01000058_01625351_01664692 PIK3C2B coding upstream 193940 1625351 ~ 1665794 (+)
CI01000058_01580247_01591754 NA coding upstream 267481 1579663 ~ 1592253 (+)
CI01000058_01957358_02009847 ATP2B4 coding downstream 97378 1957358 ~ 2009847 (+)
CI01000058_02028188_02037502 MDM4 coding downstream 168169 2028149 ~ 2037628 (+)
CI01000058_02052152_02085378 NA coding downstream 191983 2051963 ~ 2085455 (+)
CI01000058_02227590_02229507 MYOG coding downstream 367438 2227418 ~ 2230021 (+)
CI01000058_02348646_02354404 TMEM183A coding downstream 488635 2348615 ~ 2355085 (+)
G248139 NA non-coding upstream 1668 1857684 ~ 1858066 (+)
G248138 NA non-coding upstream 3206 1856310 ~ 1856528 (+)
G248135 NA non-coding upstream 7833 1851674 ~ 1851901 (+)
G248128 NA non-coding upstream 22212 1837308 ~ 1837522 (+)
G248122 NA non-coding upstream 27366 1832069 ~ 1832368 (+)
G248152 NA non-coding downstream 16999 1876979 ~ 1877182 (+)
G247977 NA non-coding downstream 21200 1881180 ~ 1927032 (+)
G247950 NA non-coding downstream 67242 1927222 ~ 1941268 (+)
G247991 NA non-coding downstream 138890 1998870 ~ 2003167 (+)
G247969 NA non-coding downstream 143317 2003297 ~ 2056291 (+)
G247940 NA other upstream 403287 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 571464 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 1262563 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 1403990 434913 ~ 455744 (+)
G250039 NA other downstream 2834428 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 2966396 4864571 ~ 4888216 (+)

Expression


Co-expression Network