G250124


Basic Information

Item Value
gene id G250124
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 4918372 ~ 4918573 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU283867
GGGGGTGGGGGTGCCTTATAATTGTCATTCTACACCAACACTTGTTTGAAATATAGTTGTCAGCAGTGGACAGCTACTAGTGGATGCTATAACAGCAAGCTGACAGAGAGTTTCGTCTAACCATCTTCAATGTACGCTGTACAATTTCAGTTCTCTCAGAAGACATCTCACTGATTCTCTGTGAAACCTGTGGAAGTATTAC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU283867 True 202 lncRNA 0.43 1 4918372 4918573

Neighbor

gene id symbol gene type direction distance location
CI01000058_04864571_04888198 NA coding upstream 30156 4864571 ~ 4888216 (+)
CI01000058_04806751_04821030 NA coding upstream 96677 4806751 ~ 4821695 (+)
CI01000058_04792565_04803181 TMF1 coding upstream 114968 4792565 ~ 4803404 (+)
CI01000058_04782847_04791049 UBA3 coding upstream 126817 4782847 ~ 4791555 (+)
CI01000058_04777182_04780095 NA coding upstream 137996 4776542 ~ 4780376 (+)
CI01000058_04923557_04926609 NA coding downstream 4717 4923290 ~ 4927654 (+)
CI01000058_05091135_05091372 NA coding downstream 172562 5091135 ~ 5092015 (+)
G250120 NA non-coding upstream 13232 4904940 ~ 4905140 (+)
G250095 NA non-coding upstream 33272 4884462 ~ 4885100 (+)
G250098 NA non-coding upstream 34093 4884005 ~ 4884279 (+)
G250075 NA non-coding upstream 179927 4727809 ~ 4738445 (+)
CI01000058_04678629_04687645 TMEM110 non-coding upstream 228852 4678102 ~ 4689520 (+)
G250187 NA non-coding downstream 166067 5084640 ~ 5137852 (+)
G250219 NA non-coding downstream 262328 5180901 ~ 5181105 (+)
G250039 NA other upstream 221211 4694408 ~ 4697161 (+)
CI01000058_01794468_01800421 KISS1 other upstream 3120640 1794468 ~ 1800421 (+)
G247940 NA other upstream 3461925 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 3630102 1278592 ~ 1289874 (+)

Expression


Co-expression Network